Bio.SearchIO.ExonerateIO package¶
Submodules¶
Module contents¶
Bio.SearchIO support for Exonerate output formats.
This module adds support for handling Exonerate outputs. Exonerate is a generic tool for pairwise sequence comparison that allows you to align sequences using several different models.
Bio.SearchIO.ExonerateIO was tested on the following Exonerate versions and models:
version: 2.2
models: - affine:local - cdna2genome - coding2coding - est2genome - genome2genome - ner - protein2dna - protein2genome - ungapped - ungapped:translated
Although model testing were not exhaustive, ExonerateIO should be able to cope with all Exonerate models. Please file a bug report if you stumble upon an unparseable file.
More information on Exonerate is available on its home page at www.ebi.ac.uk/~guy/exonerate/
Supported Formats¶
Plain text alignment - ‘exonerate-text’ - parsing, indexing
Vulgar line - ‘exonerate-vulgar’ - parsing, indexing
Cigar line - ‘exonerate-cigar’ - parsing, indexing
On Exonerate, these output formats are not exclusive to one another. For example, you may have both plain text and vulgar output in the same file. ExonerateIO can only handle one of these at a time, however. If you have a file containing both plain text and vulgar lines, for example, you have to pick either ‘exonerate-text’ or ‘exonerate-vulgar’ to parse it.
Due to the cigar format specification, many features of the alignments such as introns or frameshifts may be collapsed into a single feature (in this case, they are labelled ‘D’ for ‘deletion’). The parser does not attempt to guess whether the D label it encounters is a real deletion or a collapsed feature. As such, parsing or indexing using ‘exonerate-cigar’ may yield different results compared to ‘exonerate-text’ or ‘exonerate-vulgar’.
exonerate-text¶
The plain text output / C4 alignment is the output triggered by the ‘–showalignemnt’ flag. Compared to the two other output formats, this format contains the most information, having the complete query and hit sequences of the alignment.
Here are some examples of the C4 output alignment that ExonerateIO can handle (coordinates not written in scale):
1. simple ungapped alignments
1 : ATGGGCAATATCCTTCGGAAAGGTCAGCAAAT : 56
||||||||||||||||||||||||||||||||
1319275 : ATGGGCAATATCCTTCGGAAAGGTCAGCAAAT : 1319220
2. alignments with frameshifts:
129 : -TGCCGTTACCAT----GACGAAAGTATTAAT : 160
-CysArgTyrHis----AspGluSerIleAsn
#||||||||||||####|||||||||||||||
#CysArgTyrHis####AspGluSerIleAsn
1234593 : GTGCCGTTACCATCGGTGACGAAAGTATTAAT : 1234630
3. alignments with introns and split codons:
382 : {A} {CC}AAA : 358
AAA{T} >>>> Target Intron 3 >>>> {hr}LysATGAGCGATGAAAATA
|| { }++ 55423 bp ++{ } ! ||| ||||||||||
AAC{L}gt.........................ag{eu}AspTTGAATGATGAAAATA
42322 : {C} {TG}GAT : 97769
4. alignments with NER blocks
111 : CAGAAAA--< 31 >--CTGCCCAGAAT--< 10 >--AACGAGCGTTCCG- : 184
| |||||--< NER 1 >--| ||||| | |--< NER 2 >--||| | ||||||-
297911 : CTGAAAA--< 29 >--CCGCCCAAAGT--< 13 >--AACTGGAGTTCCG- : 297993
ExonerateIO utilizes the HSPFragment model quite extensively to deal with non- ungapped alignments. For any single HSPFragment, if ExonerateIO sees an intron, a NER block, or a frameshift, it will break the fragment into two HSPFragment objects and adjust each of their start and end coordinate appropriately.
You may notice that Exonerate always uses the three letter amino acid codes to
display protein sequences. If the protein itself is part of the query sequence,
such as in the protein2dna model, ExonerateIO will transform the protein
sequence into using one letter codes. This is because the SeqRecord objects that
store the sequences are designed for single-letter sequences only. If Exonerate
also outputs the underlying nucleotide sequence, it will be saved into an
aln_annotation
entry as a list of triplets.
If the protein sequence is not part of the actual alignment, such as in the
est2genome or genome2genome models, ExonerateIO will keep the three letter codes
and store them as aln_annotation
entries. In these cases, the hit and
query sequences may be used directly as SeqRecord objects as they are one-letter
nucleotide codes. The three-letter protein sequences are then stored as entries
in the aln_annotation
dictionary.
For ‘exonerate-text’, ExonerateIO provides the following object attributes:
Object |
Attribute |
Value |
---|---|---|
QueryResult |
description |
query sequence description |
id |
query sequence ID |
|
model |
alignment model |
|
program |
‘exonerate’ |
|
Hit |
description |
hit sequence description |
id |
hit sequence ID |
|
HSP |
hit_split_codons |
list of split codon coordinates in the hit sequence |
score |
alignment score |
|
query_split_codons |
list of split codon coordinates in the query sequence |
|
HSPFragment |
aln_annotation |
alignment similarity string, hit sequence annotation, and/or query sequence annotation |
hit |
hit sequence |
|
hit_end |
hit sequence end coordinate |
|
hit_frame |
hit sequence reading frame |
|
hit_start |
hit sequence start coordinate |
|
hit_strand |
hit sequence strand |
|
query |
query sequence |
|
query_end |
query sequence end coordinate |
|
query_frame |
query sequence reading frame |
|
query_start |
query sequence start coordinate |
|
query_strand |
query sequence strand |
Note that you can also use the default HSP or HSPFragment properties. For
example, to check the intron coordinates of your result you can use the
query_inter_ranges
or hit_inter_ranges
properties:
>>> from Bio import SearchIO
>>> fname = 'Exonerate/exn_22_m_genome2genome.exn'
>>> all_qresult = list(SearchIO.parse(fname, 'exonerate-text'))
>>> hsp = all_qresult[-1][-1][-1] # last qresult, last hit, last hsp
>>> hsp
HSP(...)
>>> hsp.query_inter_ranges
[(388, 449), (284, 319), (198, 198), (114, 161)]
>>> hsp.hit_inter_ranges
[(487387, 641682), (386207, 487327), (208677, 386123), (71917, 208639)]
Here you can see that for both query and hit introns, the coordinates in each tuple is always (start, end) where start <= end. But when you compare each tuple to the next, the coordinates decrease. This is an indication that both the query and hit sequences lie on the minus strand. Exonerate outputs minus strand results in a decreasing manner; the start coordinate is always bigger than the end coordinate. ExonerateIO preserves the fragment ordering as a whole, but uses its own standard to store an individual fragment’s start and end coordinates.
You may also notice that the third tuple in query_inter_ranges
is (198, 198),
two exact same numbers. This means that the query sequence does not have any
gaps at that position. The gap is only present in the hit sequence, where we see
that the third tuple contains (208677, 386123), a gap of about 177k bases.
Another example is to use the hit_frame_all
and query_frame_all
to see if
there are any frameshifts in your alignment:
>>> from Bio import SearchIO
>>> fname = 'Exonerate/exn_22_m_coding2coding_fshifts.exn'
>>> qresult = next(SearchIO.parse(fname, 'exonerate-text'))
>>> hsp = qresult[0][0] # first hit, first hsp
>>> hsp
HSP(...)
>>> hsp.query_frame_all
[1, 2, 2, 2]
>>> hsp.hit_frame_all
[1, 1, 3, 1]
Here you can see that the alignment as a whole has three frameshifts. The first one occurs in the query sequence, after the first fragment (1 -> 2 shift), the second one occurs in the hit sequence, after the second fragment (1 -> 3 shift), and the last one also occurs in the hit sequence, before the last fragment (3 -> 1 shift).
There are other default HSP properties that you can use to ease your workflow. Please refer to the HSP object documentation for more details.
exonerate-vulgar¶
The vulgar format provides a compact way of representing alignments created by Exonerate. In general, it contains the same information as the plain text output except for the ‘model’ information and the actual sequences themselves. You can expect that the coordinates obtained from using ‘exonerate-text’ and ‘exonerate-vulgar’ to be the same. Both formats also creates HSPFragment using the same triggers: introns, NER blocks, and/or frameshifts.
exonerate-cigar¶
The cigar format provides an even more compact representation of Exonerate alignments. However, this comes with a cost of losing information. In the cigar format, for example, introns are treated as simple deletions. This makes it impossible for the parser to distinguish between simple deletions or intron regions. As such, ‘exonerate-cigar’ may produce different sets of coordinates and fragments compared to ‘exonerate-vulgar’ or ‘exonerate-text’.