Talk:SeqIO
From Biopython
Revision as of 14:15, 29 May 2007 by Dalloliogm (Talk | contribs)
Hi, I am a newbie of Biopython. I tested Bio.SeqIO.parse on EMBL formated miRNA.dat from the microRNA Registry. But I got an error. Is the EMBL format supported fully? As:
>>>from Bio import SeqIO
>>>handle = open('/home/liang/Desktop/miRNA.dat','rU')
>>>record_iterator = SeqIO.parse(handle,'embl')
>>>first_record=record_iterator.next()
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "/usr/lib/python2.5/site-packages/Bio/GenBank/Scanner.py", line 410, in parse_records
record = self.parse(handle)
File "/usr/lib/python2.5/site-packages/Bio/GenBank/Scanner.py", line 393, in parse
if self.feed(handle, consumer) :
File "/usr/lib/python2.5/site-packages/Bio/GenBank/Scanner.py", line 360, in feed
self._feed_first_line(consumer, self.line)
File "/usr/lib/python2.5/site-packages/Bio/GenBank/Scanner.py", line 540, in _feed_first_line
assert len(fields) == 7
AssertionError
- Questions like this will probably be answered faster if you post them to the BioPython mail list. --Cjfields 16:03, 23 May 2007 (EDT)
SeqIO.to_dict() - how to specify SeqRecord Alphabet
Hi, nice work with this module!
The to_dict() method creates a dictionary with biopython SeqRecord objects.
record_dict = SeqIO.to_dict(SeqIO.parse(handle, "fasta"))
How can I specify which Alphabet do they must have? By default, they have SingleLetterAlphabet.
Chromosome cneo_JEC21:cn-jec21_chr11:
ID: cneo_JEC21:cn-jec21_chr11
Name: cneo_JEC21:cn-jec21_chr11
Desription: cneo_JEC21:cn-jec21_chr11
Seq('CCCCCTAACCCCCTAACCCCCTAACCCCCTAACCCCCTAACCCCTAACCCCCTAACCCTA ...', SingleLetterAlphabet())