SeqRecord

(Difference between revisions)
Jump to: navigation, search
(Placeholder, needs work)
 
Line 1: Line 1:
−
This page will describe the SeqRecord object used in BioPython to hold a sequence (as a Seq object) with identifiers (ID and name), description and optionally annotation and sub-features.
+
This page will describe the SeqRecord object used in BioPython to hold a sequence (as a [[Seq]] object) with identifiers (ID and name), description and optionally annotation and sub-features.
  
 
Most of the sequence file format parsers in BioPython can return SeqRecord objects  (and may offer a format specific record object too).  The new [[SeqIO]] system will only return SeqRecord objects.
 
Most of the sequence file format parsers in BioPython can return SeqRecord objects  (and may offer a format specific record object too).  The new [[SeqIO]] system will only return SeqRecord objects.
 +
 +
Lets look in closer detail at the well annotated SeqRecord objects Biopython creates from a GenBank file, such as [[http://biopython.org/DIST/docs/tutorial/examples/ls_orchid.gbk ls_orchid.gbk]].  This file contains 94 records:
 +
 +
<python>
 +
from Bio import SeqIO
 +
for index, record in enumerate(SeqIO.parse(open("ls_orchid.gbk"), "genbank")) :
 +
    print "index %i, ID = %s, length %i, with %i features" \
 +
          % (index, record.id, len(record.seq), len(record.features))
 +
</python>
 +
 +
And this is some of the output. Remember python likes to count from zero, so for the 94 records in this file they have been labelled 0 to 93:
 +
 +
index 0, ID = Z78533.1, length 740, with 5 features
 +
index 1, ID = Z78532.1, length 753, with 5 features
 +
index 2, ID = Z78531.1, length 748, with 5 features
 +
...
 +
index 92, ID = Z78440.1, length 744, with 5 features
 +
index 93, ID = Z78439.1, length 592, with 5 features
 +
 +
Lets look in a little more detail at the final record:
 +
 +
<python>
 +
print record
 +
</python>
 +
 +
That should give you a hint of the sort of information held in this object:
 +
 +
ID: Z78439.1
 +
Name: Z78439
 +
Desription: P.barbatum 5.8S rRNA gene and ITS1 and ITS2 DNA.
 +
/source=Paphiopedilum barbatum
 +
/taxonomy=['Eukaryota', 'Viridiplantae', 'Streptophyta', 'Embryophyta', ..., 'Paphiopedilum']
 +
/keywords=['5.8S ribosomal RNA', '5.8S rRNA gene', 'internal transcribed spacer', 'ITS1', 'ITS2']
 +
/references=[<Bio.SeqFeature.Reference ...>, <Bio.SeqFeature.Reference ...>]
 +
/data_file_division=PLN
 +
/date=30-NOV-2006
 +
/organism=Paphiopedilum barbatum
 +
/gi=2765564
 +
Seq('CATTGTTGAGATCACATAATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTTGGTC ...', IUPACAmbiguousDNA())
 +
 +
Lets look a little more closely... we'll start with the '''seq''' property:
 +
 +
<python>
 +
print record.seq
 +
</python>
 +
 +
That should give:
 +
 +
Seq('CATTGTTGAGATCACATAATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTTGGTC ...', IUPACAmbiguousDNA())
 +
 +
This is a [[Seq]] object, another important object type in Biopython, and worth of its own page on the wiki documentation.
 +
 +
The next three properties are all simple strings:
 +
 +
<python>
 +
print record.id
 +
print record.name
 +
print record.description
 +
</python>
 +
 +
Z78439.1
 +
Z78439
 +
P.barbatum 5.8S rRNA gene and ITS1 and ITS2 DNA.
 +
 +
Have a look at the raw GenBank file to see where these came from.

Revision as of 20:37, 18 August 2007

This page will describe the SeqRecord object used in BioPython to hold a sequence (as a Seq object) with identifiers (ID and name), description and optionally annotation and sub-features.

Most of the sequence file format parsers in BioPython can return SeqRecord objects (and may offer a format specific record object too). The new SeqIO system will only return SeqRecord objects.

Lets look in closer detail at the well annotated SeqRecord objects Biopython creates from a GenBank file, such as [ls_orchid.gbk]. This file contains 94 records: 

from Bio import SeqIO
for index, record in enumerate(SeqIO.parse(open("ls_orchid.gbk"), "genbank")) :
    print "index %i, ID = %s, length %i, with %i features" \
          % (index, record.id, len(record.seq), len(record.features))

And this is some of the output. Remember python likes to count from zero, so for the 94 records in this file they have been labelled 0 to 93: 

index 0, ID = Z78533.1, length 740, with 5 features
index 1, ID = Z78532.1, length 753, with 5 features
index 2, ID = Z78531.1, length 748, with 5 features
...
index 92, ID = Z78440.1, length 744, with 5 features
index 93, ID = Z78439.1, length 592, with 5 features

Lets look in a little more detail at the final record: 

print record

That should give you a hint of the sort of information held in this object: 

ID: Z78439.1
Name: Z78439
Desription: P.barbatum 5.8S rRNA gene and ITS1 and ITS2 DNA.
/source=Paphiopedilum barbatum
/taxonomy=['Eukaryota', 'Viridiplantae', 'Streptophyta', 'Embryophyta', ..., 'Paphiopedilum']
/keywords=['5.8S ribosomal RNA', '5.8S rRNA gene', 'internal transcribed spacer', 'ITS1', 'ITS2']
/references=[<Bio.SeqFeature.Reference ...>, <Bio.SeqFeature.Reference ...>]
/data_file_division=PLN
/date=30-NOV-2006
/organism=Paphiopedilum barbatum
/gi=2765564
Seq('CATTGTTGAGATCACATAATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTTGGTC ...', IUPACAmbiguousDNA())

Lets look a little more closely... we'll start with the seq property: 

print record.seq

That should give: 

Seq('CATTGTTGAGATCACATAATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTTGGTC ...', IUPACAmbiguousDNA())

This is a Seq object, another important object type in Biopython, and worth of its own page on the wiki documentation.

The next three properties are all simple strings: 

print record.id
print record.name
print record.description
Z78439.1
Z78439
P.barbatum 5.8S rRNA gene and ITS1 and ITS2 DNA.

Have a look at the raw GenBank file to see where these came from.

Retrieved from "http://biopython.org/w/index.php?title=SeqRecord&oldid=1901"
Personal tools
Namespaces
Variants
Actions
Navigation
Toolbox