PhyloXML
This module handles the parsing, generation and manipulation of files in the phyloXML format.
This code is not yet part of Biopython, and therefore the documentation has not been integrated into the Biopython Tutorial yet either.
Contents |
Installation
The source code for this module currently lives on the phyloxml branch in GitHub. If you're interested in testing this code before it's been merged into Biopython, follow the instructions there to create your own fork, or just clone the phyloxml branch onto your machine.
Requirements:
- Biopython 1.50 or newer (older may work, but hasn't been tested)
- Python 2.4 or newer
- ElementTree module
The XML parser used in this module is ElementTree, new to the Python standard library in Python 2.5. To use this module in Python 2.4, you'll need to install a separate package that provides the ElementTree interface. Two exist:
- lxml
- elementtree (or cElementTree)
The module attempts to import each of these compatible ElementTree implementations until it succeeds. The given XML file handle is then parsed incrementally to instantiate an object hierarchy containing the relevant phylogenetic information.
Usage
The most useful parts of this package are available from the top level of the module:
from Bio import PhyloXML
A complete phyloXML document has a root node with the tag "phyloxml". Directly under the root is a sequence of "phylogeny" elements (phylogenetic trees), possibly followed by other arbitrary data not included in the phyloXML spec. The main structural element of these phylogenetic trees is the Clade: a tree has a clade attribute, along with other attributes, and each clade contains a series of clades (and other attributes), recursively.
The child nodes and attributes of each XML node are mapped onto classes in the PhyloXML.Tree module, keeping the names the same where possible; the XML document structure is closely mirrored in the Tree.Phyloxml objects produced by the Bio.PhyloXML package.
Parsing phyloXML files
This module provides two functions, read() and parse(). Both functions accept either a file name or an open file handle, so phyloXML data can be also loaded from compressed files, StringIO objects, and so on.
The read() function returns a single Tree.Phyloxml object representing the entire file's data. The phylogenetic trees are in the "phylogenies" attribute, and any other arbitrary data is stored in "other".
>>> phx = PhyloXML.read('phyloxml_examples.xml') >>> print phx Phyloxml >>> len(phx.phylogenies) 13 >>> len(phx.other) 1 >>> print phx.other [Other(tag='alignment', namespace='http://example.org/align')] >>> print phx.other[0].children [Other(tag='seq', namespace='http://www.phyloxml.org', value='acgtcgcggcccgtggaagtcctctcct'), Other(tag='seq', namespace='http://www.phyloxml.org', value='aggtcgcggcctgtggaagtcctctcct'), Other(tag='seq', namespace='http://www.phyloxml.org', value='taaatcgc--cccgtgg-agtccc-cct')]
If you aren't interested in the "other" data, you can use parse() to iteratively construct just the phylogenetic trees contained in the file. If there's only one tree, then the next() method on the resulting generator will return it.
>>> for tree in PhyloXML.parse('phyloxml_examples.xml'): ... print tree.name
example from Prof. Joe Felsenstein's book "Inferring Phylogenies" example from Prof. Joe Felsenstein's book "Inferring Phylogenies" same example, with support of type "bootstrap" same example, with species and sequence same example, with gene duplication information and sequence relationships similar example, with more detailed sequence data network, node B is connected to TWO nodes: AB and C ...
>>> tree = PhyloXML.parse('phyloxml_examples.xml').next() >>> tree.name 'example from Prof. Joe Felsenstein\'s book "Inferring Phylogenies"'
Writing phyloXML files
The PhyloXML.Writer module exports one function to the top level of the package: write(). It accepts a Phyloxml object (the result of read() or to_phyloxml()) and either a file name or a handle to an open file-like object. Optionally, an encoding other than UTF-8 can be specified.
>>> phx = PhyloXML.read('phyloxml_examples.xml') >>> print phx.other [Other(tag='alignment', namespace='http://example.org/align')] >>> phx.other = [] >>> PhyloXML.write(phx, 'ex_no_other.xml') >>> phx_no = PhyloXML.read('ex_no_other.xml') >>> phx_no.other []
Using PhyloXML objects
Standard Python syntactic sugar is supported wherever it's reasonable.
- str() makes a string of the object's class name and an identifier, suitable for labeling a node in generated graph
- repr() makes a string resembling the object constructor call, such that eval(repr(obj)) will return obj for simpler PhyloXML objects, and at least partially rebuild more complex objects.
- iter() is supported by Phyloxml and Clade objects, iterating over the contained phylogenies and sub-clades, respectively
- len() is supported by the same objects that support iteration, with expected results
Clade objects also support extended indexing:
tree = PhyloXML.parse('example.xml').next() assert tree.clade[0] == tree.clade.clades[0] assert tree.clade[0,1] == tree.clade.clades[0].clades[1]
Since valid Phylogeny objects always have a single clade attribute, this style of indexing is a handy way to reach specific nodes buried deep in the tree if you happen to know exactly where they are. In the future, slicing may be supported as well to grab a range a sub-clades at once.
A couple of methods allow converting a selection to a new PhyloXML object: Phylogeny.to_phyloxml() and Clade.to_phylogeny(). A few use cases:
- Parse a phyloXML containing multiple phylogenetic trees. Check each tree sequentially, and upon finding a tree with the desired characteristic, isolate it as a new PhyloXML object.
for tree in PhyloXML.parse('example.xml'): if tree.name == 'monitor lizards': return tree.to_phyloxml()
- Extract a specific sub-clade and make it a separate phylogeny (and probably a new phyloXML file).
tree = PhyloXML.parse('example.xml').next() best = None for clade in tree.clade: if (clade.confidences[0].type == 'bootstrap' and (best is None or clade.confidences[0].value > best.confidences[0].value)): best = clade phyloxml = best.to_phylogeny(rooted=True).to_phyloxml() PhyloXML.write(phyloxml, 'example_best.xml')
Integrating with the rest of Biopython
Since the phyloXML specification is very detailed, no existing Biopython classes are currently used directly by the phyloXML parser. Instead, methods are available for converting between phyloXML and standard Biopython types.
The Tree.Sequence class contains methods for converting to and from Biopython SeqRecord objects. This includes the molecular sequence (mol_seq) as a Seq object, and the protein domain architecture as list of SeqFeature objects.
At some point this module should be merged into the Biopython trunk, and it would be nice to have a common interface with Bio.Nexus and Newick. Should these three modules be reorganized to extract a common Bio.TreeIO interface? Let's discuss it at some point.
Utilities
Some additional tools are located in Bio.PhyloXML.Utils.
- dump_tags -- Print the XML tags as they are encountered in the file. For testing and debugging, mainly.
>>> PhyloXML.dump_tags('phyloxml_examples.xml')
{http://www.phyloxml.org}phyloxml
{http://www.phyloxml.org}phylogeny
{http://www.phyloxml.org}name
{http://www.phyloxml.org}description
{http://www.phyloxml.org}clade
...
- pretty_print -- Produces a plain-text representation of the entire tree. Uses str() to display nodes by default; for the longer repr() representation, add the argument show_all=True.
>>> PhyloXML.pretty_print('phyloxml_examples.xml')
Phyloxml
Phylogeny example from Prof. Joe Felsenstein's book "Inferring Phylogenies"
Clade
Clade
Clade A
Clade B
Clade C
...
>>> PhyloXML.pretty_print('phyloxml_examples.xml', show_all=True)
Phyloxml()
Phylogeny(description='phyloXML allows to use either a "branch_length"
attribute or element to indicate branch lengths.', name='example from Prof. Joe
Felsenstein's book "Inferring Phylogenies"')
Clade()
Clade(branch_length=0.06)
Clade(branch_length=0.102, name='A')
Clade(branch_length=0.23, name='B')
Clade(branch_length=0.4, name='C')
...
Performance
This parser is meant to be able to handle large files, meaning several thousand external nodes. (Benchmarks of relevant XML parsers for Python are here.) It has been tested with files of this size; for example, the complete NCBI taxonomy parses in about 100 seconds and consumes about 1.3 GB of memory. Provided enough memory is available on the system, the writer can also rebuild phyloXML files of this size.
The read() and parse() functions process a complete file in about the same amount of CPU time. Most of the underlying code is the same, and the majority of the time is spent building Clade objects. For small files (smaller than ncbi_taxonomy_mollusca.xml), the write() function serializes the complete object back to an equivalent file in around twice the CPU time required by the corresponding read() call; for large files write() is more efficient, finishing up to 3.6 times as fast as read() for the largest file tested.
Here are some times on a 2.00GHz Intel Xeon E5405 processor (only 1 CPU core used) with 7.7GB memory:
| File | Size (uncompressed) | Read (s) | Parse (s) | Write (s) |
|---|---|---|---|---|
| phyloxml_examples.xml | 15 KB | 0.0056 | 0.0053 | 0.0103 |
| apaf.xml | 38 KB | 0.0112 | 0.0112 | 0.0252 |
| bcl_2.xml | 105 KB | 0.0293 | 0.0294 | 0.0455 |
| ncbi_taxonomy_mollusca.xml | 1.5 MB | 0.688 | 0.666 | 0.683 |
| ncbi_taxonomy_metazoa.xml | 33 MB | 16.383 | 16.986 | 9.026 |
| ncbi_taxonomy.xml | 31 MB (unindented) | 99.715 | 100.588 | 27.166 |
Summer of Code project
This module is being developed by Eric Talevich as a project for Google Summer of Code 2009, with NESCent as the mentoring organization and Brad Chapman as the primary mentor.
Main SoC project page: PhyloSoC:Biopython support for parsing and writing phyloXML
Other software
Christian Zmasek, one of the authors of the phyloXML specification, has released some software that uses this format:
- Forester -- a collection of Java and Ruby libraries for working with phylogenetic data
- Archaopteryx -- Java application for the visualization of annotated phylogenetic trees (also available in applet form)
Another list is maintained at phylosoft.org.