
From Biopython
(Difference between revisions)
Jump to: navigation, search
(This is what I had to do in order to get the example to work)
(39 intermediate revisions by 2 users not shown)
Line 1: Line 1:
This module handles the parsing and generation of files in the [ phyloXML] format.
Within Bio.[[Phylo]], Biopython's module for working with phylogenetic trees, the PhyloXML and PhyloXMLIO sub-modules handle the parsing, generation and manipulation of files in the [ phyloXML] format.
This code is not yet part of Biopython, and therefore the documentation has not been integrated into the Biopython Tutorial yet either.
==About the format==
A complete phyloXML document has a root node with the tag "phyloxml". Directly under the root is a sequence of "phylogeny" elements (phylogenetic trees), possibly followed by other arbitrary data not included in the phyloXML spec. The main structural element of these phylogenetic trees is the Clade: a tree has a clade attribute, along with other attributes, and each clade contains a series of clades (and other attributes), recursively.
(Coming soon: use cases)
The child nodes and attributes of each XML node are mapped onto classes in the PhyloXML module, keeping the names the same where possible; the XML document structure is closely mirrored in the Phyloxml objects produced by, and the Phylogeny objects produced by and parse().
For example, this XML (from Tests/PhyloXML/example.xml):
The source code for this module currently lives on the [ phyloxml branch] in GitHub.
<?xml version="1.0" encoding="UTF-8"?>
<phyloxml xmlns:xsi="" xsi:schemaLocation="" xmlns="">
  <phylogeny rooted="true">
      <name>An example</name>
        <clade branch_length="0.06">
            <clade branch_length="0.102">
            <clade branch_length="0.23">
        <clade branch_length="0.4">
produces an object hierarchy like this:
The XML parser used in this module is ElementTree, new to the Python standard library in Python 2.5. To use this module in Python 2.4, you'll need to install a separate package that provides the ElementTree interface. Two exist:
* [ lxml]
>>> from Bio import Phylo
* [ elementtree] (or cElementTree)
>>> tree ='example.xml','phyloxml')
>>> print tree
Phylogeny(rooted='True', description='phyloXML allows to use either a "branch_length" attribute...',
          name='example from Prof. Joe Felsenstein's book "Inferring Phyl...')
            Clade(branch_length='0.102', name='A')
            Clade(branch_length='0.23', name='B')
        Clade(branch_length='0.4', name='C')
The module attempts to import each of these compatible ElementTree implementations until it succeeds. The given XML file handle is then parsed incrementally to instantiate an object hierarchy containing the relevant phylogenetic information. Existing Biopython classes will be reused for these objects wherever appropriate.
which represents a phylogeny like this:
This parser is meant to be able to handle large files, meaning several thousand external nodes. (Benchmarks of relevant XML parsers for Python are [ here]. To support this, the parser takes an open file handle, and the API will offer wrappers for loading compressed files, and perhaps pulling from a database or web URL, too.
>>> Phylo.draw_ascii(tree)
            __________________ A
_|          |___________________________________________ B
|___________________________________________________________________________ C
The writer portion of this module hasn't been written yet, but presumably it will be based on ElementTree as well.
The tree objects are derived from base classes in [[Phylo|Bio.Phylo]]; see that page for more about this object representation.
==I/O functions==
At some point this should be merged into the Biopython trunk, and it would be nice to have a common interface with Bio.Nexus and Newick. Should these three modules be reorganized to extract a common Bio.TreeIO interface? Let's discuss it at some point.
To start working with phyloXML files, use the [[Phylo]] package with 'phyloxml' as the format argument:
>>> from Bio import Phylo
>>> tree ='some-trees.xml', 'phyloxml')
# ValueError: There are multiple trees in this file; use parse() instead.
>>> trees = Phylo.parse('some-trees.xml', 'phyloxml')
>>> Phylo.write(, 'first-tree.xml', 'phyloxml')
>>> Phylo.write(trees, 'rest-trees.xml', 'phyloxml')
These functions work with Phylogeny objects (derived from BaseTree.Tree) from the Bio.Phylo.PhyloXML module. This standard API is enough for most use cases.
Within Bio.Phylo, the I/O functions for the phyloXML format are implemented in the PhyloXMLIO sub-module. For access to some additional functionality beyond the basic Phylo I/O API, or to skip specifying the 'phyloxml' format argument each time, this can be imported directly:
<python>from Bio.Phylo import PhyloXMLIO</python>
The read() function returns a single Bio.Phylo.PhyloXML.Phyloxml object representing the entire file's data. The phylogenetic trees are in the "phylogenies" attribute, and any other arbitrary data is stored in "other".
>>> phx ='phyloxml_examples.xml')
>>> print phx
>>> len(phx.phylogenies)
>>> len(phx.other)
>>> print phx.other
[Other(tag='alignment', namespace='')]
>>> print phx.other[0].children
[Other(tag='seq', namespace='', value='acgtcgcggcccgtggaagtcctctcct'),
Other(tag='seq', namespace='', value='aggtcgcggcctgtggaagtcctctcct'),
Other(tag='seq', namespace='', value='taaatcgc--cccgtgg-agtccc-cct')]
If you aren't interested in the "other" data, you can use parse() to iteratively construct just the phylogenetic trees contained in the file -- this is exactly the same as calling Phylo.parse() with the 'phyloxml' format argument.
PhyloXMLIO.write() is similar to Phylo.write(), but also accepts a Phyloxml object (the result of read() or to_phyloxml()) to serialize. Optionally, an encoding other than UTF-8 can be specified.
>>> phx ='phyloxml_examples.xml')
>>> print phx.other
[Other(tag='alignment', namespace='')]
>>> phx.other = []
>>> PhyloXMLIO.write(phx, 'ex_no_other.xml')
>>> phx_no ='ex_no_other.xml')
>>> phx_no.other
PhyloXMLIO also contains a utility called dump_tags() for printing all of the XML tags as they are encountered in a phyloXML file. This can be helpful for debugging, or used along with grep or sort -u on the command line to obtain a list of the tags a phyloXML file contains.
>>> PhyloXMLIO.dump_tags('phyloxml_examples.xml')
==Using PhyloXML objects==
Standard Python syntactic sugar is supported wherever it's reasonable.
* str() makes a string of the object's class name and an identifier, suitable for labeling a node in generated graph
* repr() makes a string resembling the object constructor call, such that <tt>eval(repr(obj))</tt> will return <tt>obj</tt> for simpler PhyloXML objects, and at least partially rebuild more complex objects.
* iter() is supported by Phyloxml and Clade objects, iterating over the contained phylogenies and sub-clades, respectively
* len() is supported by the same objects that support iteration, with expected results
Clade objects also support slicing and multiple indexing:
tree = Phylo.parse('example.xml', 'phyloxml').next()
assert tree.clade[0] == tree.clade.clades[0]
assert tree.clade[0,1] == tree.clade.clades[0].clades[1]
Since valid Phylogeny objects always have a single clade attribute, this style of indexing is a handy way to reach specific nodes buried deep in the tree if you happen to know exactly where they are.
A couple of methods allow converting a selection to a new PhyloXML object: Phylogeny.to_phyloxml() and Clade.to_phylogeny(). A few use cases:
* Parse a phyloXML containing multiple phylogenetic trees. Check each tree sequentially, and upon finding a tree with the desired characteristic, isolate it as a new PhyloXML object.
for tree in Phylo.parse('example.xml', 'phyloxml'):
    if == 'monitor lizards':
        return tree.to_phyloxml()
* Extract a specific sub-clade and make it a separate phylogeny (and probably a new phyloXML file).
tree = Phylo.parse('example.xml', 'phyloxml').next()
best = None
for clade in tree.clade:
    if (clade.confidences[0].type == 'bootstrap'
            and (best is None
                or clade.confidences[0].value > best.confidences[0].value)):
        best = clade
phyloxml = best.to_phylogeny(rooted=True).to_phyloxml()
Phylo.write(phyloxml, 'example_best.xml', 'phyloxml')
===Core classes===
* Container for phylogenies; not used by the top-level Bio.Phylo I/O functions
* Derived from Tree -- the global tree object
* Derived from Subtree -- represents a node in the object tree, and local info
* Represents data included in the phyloXML file but not described by the phyloXML specification
===Annotation types===
'''(to do)'''
===Integrating with the rest of Biopython===
The classes used by this module inherit from the [[Phylo]] module's generalized BaseTree classes, and therefore have access to the methods defined on those base classes. Since the phyloXML specification is very detailed, these subclasses are kept in a separate module, Bio.Phylo.PhyloXML, and offer additional methods for converting between phyloXML and standard Biopython types.
The PhyloXML.Sequence class contains methods for converting to and from Biopython [[SeqRecord]] objects -- to_seqrecord() and from_seqrecord(). This includes the molecular sequence (mol_seq) as a [[Seq]] object, and the protein domain architecture as list of [[SeqFeature]] objects. Likewise, PhyloXML.ProteinDomain objects have a to_seqfeature() method.
This parser is meant to be able to handle large files, meaning several thousand external nodes. (Benchmarks of relevant XML parsers for Python are [ here].) It has been tested with files of this size; for example, the complete NCBI taxonomy parses in about 100 seconds and consumes about 1.3 GB of memory. Provided enough memory is available on the system, the writer can also rebuild phyloXML files of this size.
The read() and parse() functions process a complete file in about the same amount of CPU time. Most of the underlying code is the same, and the majority of the time is spent building Clade objects (the most common node type). For small files (smaller than ncbi_taxonomy_mollusca.xml), the write() function serializes the complete object back to an equivalent file slightly slower than the corresponding read() call; for very large files, write() finishes faster than read().
Here are some times on a 2.00GHz Intel Xeon E5405 processor (only 1 CPU core used) with 7.7GB memory, running the standard Python 2.6.2 on Ubuntu 9.04, choosing the best of 3 runs for each function:
{| border="1" padding="0"
!File !! Ext. Nodes !! Size (uncompressed) !! Read (s) !! Parse (s) !! Write (s)
|38 KB
|105 KB
|1.5 MB
|46 MB
|33 MB
|31 MB (unindented)
On 32-bit architectures, [ psyco] might improve these times significantly, at the risk of increasing memory usage. (I haven't tested it.) For comparison, the Java-based parser used in Forester and ATV (see below) reads the same files about 3-5 times as quickly, or up to 15x for the largest file.
For Python 2.4, performance depends on which ElementTree implementation is used. Using the original pure-Python elementtree, reading/parsing takes about twice as much time for all file sizes, but writing is only significantly slower for very large files.
==Summer of Code project==
==Summer of Code project==
This module is being developed by [[User:EricTalevich|Eric]] as a project for Google Summer of Code 2009, with NESCent as the mentoring organization and Brad as the primary mentor.
This module was developed by [[User:EricTalevich|Eric Talevich]] as a Google Summer of Code 2009 project to provide support for phyloXML in Biopython, with NESCent as the mentoring organization and Brad Chapman and Christian Zmasek as the mentors. The main page for the project is here: [ PhyloSoC:Biopython support for parsing and writing phyloXML]
Main SoC project page: [ PhyloSoC:Biopython support for parsing and writing phyloXML]
The [[Phylo]] module was developed afterward in order to integrate this code with the rest of Biopython.
==Other software==
==Related software==
[ Christian Zmasek], author of the phyloXML specification, has released some software that uses this format:
[ Christian Zmasek], one of the authors of the phyloXML specification, has released some software that uses this format:
* [ Forester] -- a collection of Java and Ruby libraries for working with phylogenetic data
* [ Forester] -- a collection of Java and Ruby libraries for working with phylogenetic data

Latest revision as of 18:06, 11 January 2011

Within Bio.Phylo, Biopython's module for working with phylogenetic trees, the PhyloXML and PhyloXMLIO sub-modules handle the parsing, generation and manipulation of files in the phyloXML format.


About the format

A complete phyloXML document has a root node with the tag "phyloxml". Directly under the root is a sequence of "phylogeny" elements (phylogenetic trees), possibly followed by other arbitrary data not included in the phyloXML spec. The main structural element of these phylogenetic trees is the Clade: a tree has a clade attribute, along with other attributes, and each clade contains a series of clades (and other attributes), recursively.

The child nodes and attributes of each XML node are mapped onto classes in the PhyloXML module, keeping the names the same where possible; the XML document structure is closely mirrored in the Phyloxml objects produced by, and the Phylogeny objects produced by and parse().

For example, this XML (from Tests/PhyloXML/example.xml):

<?xml version="1.0" encoding="UTF-8"?>
<phyloxml xmlns:xsi="" xsi:schemaLocation="" xmlns="">
   <phylogeny rooted="true">
      <name>An example</name>
         <clade branch_length="0.06">
            <clade branch_length="0.102">
            <clade branch_length="0.23">
         <clade branch_length="0.4">

produces an object hierarchy like this:

>>> from Bio import Phylo
>>> tree ='example.xml','phyloxml')
>>> print tree
Phylogeny(rooted='True', description='phyloXML allows to use either a "branch_length" attribute...',
          name='example from Prof. Joe Felsenstein's book "Inferring Phyl...')
            Clade(branch_length='0.102', name='A')
            Clade(branch_length='0.23', name='B')
        Clade(branch_length='0.4', name='C')

which represents a phylogeny like this:

>>> Phylo.draw_ascii(tree)
             __________________ A
_|          |___________________________________________ B
 |___________________________________________________________________________ C

The tree objects are derived from base classes in Bio.Phylo; see that page for more about this object representation.

I/O functions

To start working with phyloXML files, use the Phylo package with 'phyloxml' as the format argument:

>>> from Bio import Phylo
>>> tree ='some-trees.xml', 'phyloxml')
# ValueError: There are multiple trees in this file; use parse() instead.
>>> trees = Phylo.parse('some-trees.xml', 'phyloxml')
>>> Phylo.write(, 'first-tree.xml', 'phyloxml')
>>> Phylo.write(trees, 'rest-trees.xml', 'phyloxml')

These functions work with Phylogeny objects (derived from BaseTree.Tree) from the Bio.Phylo.PhyloXML module. This standard API is enough for most use cases.


Within Bio.Phylo, the I/O functions for the phyloXML format are implemented in the PhyloXMLIO sub-module. For access to some additional functionality beyond the basic Phylo I/O API, or to skip specifying the 'phyloxml' format argument each time, this can be imported directly:

from Bio.Phylo import PhyloXMLIO

The read() function returns a single Bio.Phylo.PhyloXML.Phyloxml object representing the entire file's data. The phylogenetic trees are in the "phylogenies" attribute, and any other arbitrary data is stored in "other".

>>> phx ='phyloxml_examples.xml')
>>> print phx
>>> len(phx.phylogenies)
>>> len(phx.other)
>>> print phx.other
[Other(tag='alignment', namespace='')]
>>> print phx.other[0].children
[Other(tag='seq', namespace='', value='acgtcgcggcccgtggaagtcctctcct'),
Other(tag='seq', namespace='', value='aggtcgcggcctgtggaagtcctctcct'),
Other(tag='seq', namespace='', value='taaatcgc--cccgtgg-agtccc-cct')]

If you aren't interested in the "other" data, you can use parse() to iteratively construct just the phylogenetic trees contained in the file -- this is exactly the same as calling Phylo.parse() with the 'phyloxml' format argument.

PhyloXMLIO.write() is similar to Phylo.write(), but also accepts a Phyloxml object (the result of read() or to_phyloxml()) to serialize. Optionally, an encoding other than UTF-8 can be specified.

>>> phx ='phyloxml_examples.xml')
>>> print phx.other
[Other(tag='alignment', namespace='')]
>>> phx.other = []
>>> PhyloXMLIO.write(phx, 'ex_no_other.xml')
>>> phx_no ='ex_no_other.xml')
>>> phx_no.other

PhyloXMLIO also contains a utility called dump_tags() for printing all of the XML tags as they are encountered in a phyloXML file. This can be helpful for debugging, or used along with grep or sort -u on the command line to obtain a list of the tags a phyloXML file contains.

>>> PhyloXMLIO.dump_tags('phyloxml_examples.xml')

Using PhyloXML objects

Standard Python syntactic sugar is supported wherever it's reasonable.

  • str() makes a string of the object's class name and an identifier, suitable for labeling a node in generated graph
  • repr() makes a string resembling the object constructor call, such that eval(repr(obj)) will return obj for simpler PhyloXML objects, and at least partially rebuild more complex objects.
  • iter() is supported by Phyloxml and Clade objects, iterating over the contained phylogenies and sub-clades, respectively
  • len() is supported by the same objects that support iteration, with expected results

Clade objects also support slicing and multiple indexing:

tree = Phylo.parse('example.xml', 'phyloxml').next()
assert tree.clade[0] == tree.clade.clades[0]
assert tree.clade[0,1] == tree.clade.clades[0].clades[1]

Since valid Phylogeny objects always have a single clade attribute, this style of indexing is a handy way to reach specific nodes buried deep in the tree if you happen to know exactly where they are.

A couple of methods allow converting a selection to a new PhyloXML object: Phylogeny.to_phyloxml() and Clade.to_phylogeny(). A few use cases:

  • Parse a phyloXML containing multiple phylogenetic trees. Check each tree sequentially, and upon finding a tree with the desired characteristic, isolate it as a new PhyloXML object.
for tree in Phylo.parse('example.xml', 'phyloxml'):
    if == 'monitor lizards':
        return tree.to_phyloxml()
  • Extract a specific sub-clade and make it a separate phylogeny (and probably a new phyloXML file).
tree = Phylo.parse('example.xml', 'phyloxml').next()
best = None
for clade in tree.clade:
    if (clade.confidences[0].type == 'bootstrap'
            and (best is None
                or clade.confidences[0].value > best.confidences[0].value)):
        best = clade
phyloxml = best.to_phylogeny(rooted=True).to_phyloxml()
Phylo.write(phyloxml, 'example_best.xml', 'phyloxml')

Core classes


  • Container for phylogenies; not used by the top-level Bio.Phylo I/O functions


  • Derived from Tree -- the global tree object


  • Derived from Subtree -- represents a node in the object tree, and local info


  • Represents data included in the phyloXML file but not described by the phyloXML specification

Annotation types

(to do)

Integrating with the rest of Biopython

The classes used by this module inherit from the Phylo module's generalized BaseTree classes, and therefore have access to the methods defined on those base classes. Since the phyloXML specification is very detailed, these subclasses are kept in a separate module, Bio.Phylo.PhyloXML, and offer additional methods for converting between phyloXML and standard Biopython types.

The PhyloXML.Sequence class contains methods for converting to and from Biopython SeqRecord objects -- to_seqrecord() and from_seqrecord(). This includes the molecular sequence (mol_seq) as a Seq object, and the protein domain architecture as list of SeqFeature objects. Likewise, PhyloXML.ProteinDomain objects have a to_seqfeature() method.


This parser is meant to be able to handle large files, meaning several thousand external nodes. (Benchmarks of relevant XML parsers for Python are here.) It has been tested with files of this size; for example, the complete NCBI taxonomy parses in about 100 seconds and consumes about 1.3 GB of memory. Provided enough memory is available on the system, the writer can also rebuild phyloXML files of this size.

The read() and parse() functions process a complete file in about the same amount of CPU time. Most of the underlying code is the same, and the majority of the time is spent building Clade objects (the most common node type). For small files (smaller than ncbi_taxonomy_mollusca.xml), the write() function serializes the complete object back to an equivalent file slightly slower than the corresponding read() call; for very large files, write() finishes faster than read().

Here are some times on a 2.00GHz Intel Xeon E5405 processor (only 1 CPU core used) with 7.7GB memory, running the standard Python 2.6.2 on Ubuntu 9.04, choosing the best of 3 runs for each function:

File Ext. Nodes Size (uncompressed) Read (s) Parse (s) Write (s)
apaf.xml 38 KB 0.01 0.01 0.02
bcl_2.xml 105 KB 0.02 0.02 0.04
ncbi_taxonomy_mollusca.xml 5632 1.5 MB 0.51 0.49 0.80
tol_life_on_earth_1.xml 57124 46 MB 10.28 10.67 10.36
ncbi_taxonomy_metazoa.xml 73907 33 MB 15.76 16.15 10.69
ncbi_taxonomy.xml 263691 31 MB (unindented) 109.70 109.14 32.39

On 32-bit architectures, psyco might improve these times significantly, at the risk of increasing memory usage. (I haven't tested it.) For comparison, the Java-based parser used in Forester and ATV (see below) reads the same files about 3-5 times as quickly, or up to 15x for the largest file.

For Python 2.4, performance depends on which ElementTree implementation is used. Using the original pure-Python elementtree, reading/parsing takes about twice as much time for all file sizes, but writing is only significantly slower for very large files.

Summer of Code project

This module was developed by Eric Talevich as a Google Summer of Code 2009 project to provide support for phyloXML in Biopython, with NESCent as the mentoring organization and Brad Chapman and Christian Zmasek as the mentors. The main page for the project is here: PhyloSoC:Biopython support for parsing and writing phyloXML

The Phylo module was developed afterward in order to integrate this code with the rest of Biopython.

Related software

Christian Zmasek, one of the authors of the phyloXML specification, has released some software that uses this format:

  • Forester -- a collection of Java and Ruby libraries for working with phylogenetic data
  • Archaopteryx -- Java application for the visualization of annotated phylogenetic trees (also available in applet form)

Another list is maintained at

Personal tools