Concatenate nexus
| Line 1: | Line 1: | ||
==The Problem== | ==The Problem== | ||
| − | It | + | It is common to make species-level phylogenetic inferences from multiple genes or proteins. Demographic (and other) processes can cause single gene trees to diverge from the species tree, so support from multiple genes for the same tree topology is considered stronger evidence than single gene inferences (of course, we still need to test that each gene is telling the same story). |
| − | This is usually handled by aligning each gene separately then creating a single "supermatrix" from the individual | + | This is usually handled by aligning each gene separately then creating a single "supermatrix" from the individual gene alignments, i.e. you create a single alignment containing one row for each taxon where the data for each row is the concatenated aligned gene sequences for the taxon. In NEXUS files (used by the phylogenetic software PAUP*, MrBayes, and others) multiple genes can be explicitly represented as different 'character partitions' or 'sets' within a data matrix that contains one long sequence for each taxon. In this way you can create a supermatrix but still apply different substitution models to each gene within in it or run PAUP*'s Partition Homogeneity Test to check for significant difference in the rate/topology of each gene tree. |
| − | sequence for each taxon. In this way you can create a supermatrix but still apply different | + | |
| − | The Bio.Nexus module makes | + | The Bio.Nexus module makes concatenating multiple alignments into a supermatrix relatively straight forward. |
| Line 11: | Line 10: | ||
==The Solution== | ==The Solution== | ||
| − | Say we have | + | Say we have NEXUS files for three genes, btCOI.nex, btCOII,nex and btITS.nex, that we want to combine. |
<python> | <python> | ||
from Bio.Nexus import Nexus | from Bio.Nexus import Nexus | ||
| Line 45: | Line 44: | ||
</pre> | </pre> | ||
| − | Ahh, it was too easy. The ITS file had a taxon that wasn't in other files so it was added with lots of missing data. Sometimes this might be the result you want but having a few taxa like this is also a very good way to make a Partition Homogeneity Test run for a week. Lets write a function that tests that the same taxa are represented in a set of nexus instances and provides a useful error message if not ( | + | Ahh, it was too easy. The ITS file had a taxon that wasn't in other files so it was added with lots of missing data. Sometimes this might be the result you want but having a few taxa like this is also a very good way to make a Partition Homogeneity Test run for a week. Lets write a function that tests that the same taxa are represented in a set of nexus instances and provides a useful error message if not (i.e., what to delete from your NEXUS files if you want them to combine nicely) |
<python> | <python> | ||
Revision as of 10:13, 15 May 2009
The Problem
It is common to make species-level phylogenetic inferences from multiple genes or proteins. Demographic (and other) processes can cause single gene trees to diverge from the species tree, so support from multiple genes for the same tree topology is considered stronger evidence than single gene inferences (of course, we still need to test that each gene is telling the same story).
This is usually handled by aligning each gene separately then creating a single "supermatrix" from the individual gene alignments, i.e. you create a single alignment containing one row for each taxon where the data for each row is the concatenated aligned gene sequences for the taxon. In NEXUS files (used by the phylogenetic software PAUP*, MrBayes, and others) multiple genes can be explicitly represented as different 'character partitions' or 'sets' within a data matrix that contains one long sequence for each taxon. In this way you can create a supermatrix but still apply different substitution models to each gene within in it or run PAUP*'s Partition Homogeneity Test to check for significant difference in the rate/topology of each gene tree.
The Bio.Nexus module makes concatenating multiple alignments into a supermatrix relatively straight forward.
The Solution
Say we have NEXUS files for three genes, btCOI.nex, btCOII,nex and btITS.nex, that we want to combine.
from Bio.Nexus import Nexus # the combine function takes a list [(name, nexus instance)...], if we provide the # file handles in a list we can use a list comprehension to make one easily handles = [open('btCOI.nex', 'r'), open('btCOII.nex', 'r'), open('btITS.nex', 'r')] nexi = [(handle.name, Nexus.Nexus(handle)) for handle in file_list] combined = Nexus.combine(nexi) combined.write_nexus_data(filename='btCOMBINED.nex')
That was easy! Lets look at our combined file
#NEXUS begin data; dimensions ntax=4 nchar=32; format datatype=dna missing=? gap=-; matrix bt1 ATGCGACTAGCAATGCGACTAGCAATGC--GA bt2 ATGCGCCTAGCAATGCGCCTAGCAATGCGGAC bt3 GTCCGACTAGCAGTCCGACTAGCAGTCCGAC- bt4 ????????????????????????GTCCGAC- ; end; begin sets; charset btCOII.nex = 13-24; charset btCOI.nex = 1-12; charset btITS.nex = 25-32; charpartition combined = btCOI.nex: 1-12, btCOII.nex: 13-24, btCOII.nex: 25-32; end;
Ahh, it was too easy. The ITS file had a taxon that wasn't in other files so it was added with lots of missing data. Sometimes this might be the result you want but having a few taxa like this is also a very good way to make a Partition Homogeneity Test run for a week. Lets write a function that tests that the same taxa are represented in a set of nexus instances and provides a useful error message if not (i.e., what to delete from your NEXUS files if you want them to combine nicely)
def check_taxa(matrices): '''Checks that nexus instances in a list [(name, instance)...] have the same taxa, provides useful error if not and returns None if everything matches ''' first_taxa = matrices[0][1].taxlabels for name, matrix in matrices[1:]: first_only = [t for t in first_taxa if t not in matrix.taxlabels] new_only = [t for t in matrix.taxlabels if t not in first_taxa] if first_only: missing = ', '.join([t for t in first_only]) msg = '%s taxa %s not in martix %s' % (nexi[0][0], missing, name) raise Nexus.NexusError(msg) elif new_only: missing = ', '.join([t for t in new_only]) msg = '%s taxa %s not in all matrices' % (name, missing) raise Nexus.NexusError(msg) return None # will only get here if it hasn't thrown an exception def concat(file_list, same_taxa=True): ''' Combine multiple nexus data matrices in one partitioned file. By default this will only work if the same taxa are present in each file use same_taxa=False if you are not concerned by this ''' nexi = [(handle.name, Nexus.Nexus(handle)) for handle in file_list] if same_taxa: if not check_taxa(nexi): return Nexus.combine(nexi) else: return Nexus.combine(nexi)
And now, using our new functions:
>>> handles = [open('btCOI.nex', 'r'), open('btCOII.nex', 'r'), open('btITS.nex', 'r')]
# If we combine them all we should get an error and the taxon/taxa that caused it
>>> concat(handles)
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "<stdin>", line 5, in concat
File "<stdin>", line 16, in check_taxa
Bio.Nexus.Nexus.NexusError: btITS.nex taxa bt4 not in all matrices
# But if we use just the first two, which do have matching taxa, it should be fine
>>> concat(handles[:2]).taxlabels
['bt1', 'bt2', 'bt3']
# Ok, can we still munge them together if we want to?
>>> concat(handle, same_taxa=False).taxlabels
['bt1', 'bt2', 'bt3', 'bt4']
Discussion
The details of the Nexus class are provided in the API Domcumentation