Concatenate nexus
(start) |
m |
||
| Line 1: | Line 1: | ||
| − | + | ==The Problem== | |
It's a good idea, if possible, to make species-level phylogenetic inferences bases on multiple genes because a) demographic processes can lead gene-trees to diverge from species trees and b) journal editors now this. Most of the alignment files supported by Biopython allow you to write multiple alignments to the same file which makes this easy. However, the nexus file format (used by PAUP* and Mr Bayes) does not. In nexus files multiple alignments need to be represented as different 'character partitions' within a data matrix that contains one long sequence for each taxon. | It's a good idea, if possible, to make species-level phylogenetic inferences bases on multiple genes because a) demographic processes can lead gene-trees to diverge from species trees and b) journal editors now this. Most of the alignment files supported by Biopython allow you to write multiple alignments to the same file which makes this easy. However, the nexus file format (used by PAUP* and Mr Bayes) does not. In nexus files multiple alignments need to be represented as different 'character partitions' within a data matrix that contains one long sequence for each taxon. | ||
| Line 5: | Line 5: | ||
The nexus class (Bio.Nexus.Nexus) has a function, combine(), that allows you to produced a new nexus instance combining the data from multiple other instances and providing the correct partitions to make sense of it. | The nexus class (Bio.Nexus.Nexus) has a function, combine(), that allows you to produced a new nexus instance combining the data from multiple other instances and providing the correct partitions to make sense of it. | ||
| − | + | ==The Solution== | |
Say we have nexus file for three genes; btCOI.nex, btCOII,nex and btITS.nex that we want to combine. | Say we have nexus file for three genes; btCOI.nex, btCOII,nex and btITS.nex that we want to combine. | ||
| Line 97: | Line 97: | ||
</pre> | </pre> | ||
| − | + | ==Discussion== | |
The details of the Nexus class are provided in the [http://www.biopython.org/DIST/docs/api/Bio.Nexus.Nexus-pysrc.html API Domcumentation] | The details of the Nexus class are provided in the [http://www.biopython.org/DIST/docs/api/Bio.Nexus.Nexus-pysrc.html API Domcumentation] | ||
Revision as of 04:37, 14 May 2009
The Problem
It's a good idea, if possible, to make species-level phylogenetic inferences bases on multiple genes because a) demographic processes can lead gene-trees to diverge from species trees and b) journal editors now this. Most of the alignment files supported by Biopython allow you to write multiple alignments to the same file which makes this easy. However, the nexus file format (used by PAUP* and Mr Bayes) does not. In nexus files multiple alignments need to be represented as different 'character partitions' within a data matrix that contains one long sequence for each taxon.
The nexus class (Bio.Nexus.Nexus) has a function, combine(), that allows you to produced a new nexus instance combining the data from multiple other instances and providing the correct partitions to make sense of it.
The Solution
Say we have nexus file for three genes; btCOI.nex, btCOII,nex and btITS.nex that we want to combine.
from Bio.Nexus import Nexus # the combine function takes a list [(name, nexus instance)...], if we provide the # file handles in a list we can use a list comprehension to make one easily handles = [open('btCOI.nex', 'r'), open('btCOII.nex', 'r'), open('btITS.nex', 'r')] nexi = [(handle.name, Nexus.Nexus(handle)) for handle in file_list] combined = Nexus.combine(nexi) combined.write_nexus_data(filename='btCOMBINED.nex')
That was easy! Lets look at our combined file
#NEXUS begin data; dimensions ntax=4 nchar=32; format datatype=dna missing=? gap=-; matrix bt1 ATGCGACTAGCAATGCGACTAGCAATGC--GA bt2 ATGCGCCTAGCAATGCGCCTAGCAATGCGGAC bt3 GTCCGACTAGCAGTCCGACTAGCAGTCCGAC- bt4 ????????????????????????GTCCGAC- ; end; begin sets; charset btCOII.nex = 13-24; charset btCOI.nex = 1-12; charset btITS.nex = 25-32; charpartition combined = btCOI.nex: 1-12, btCOII.nex: 13-24, btCOII.nex: 25-32; end;
Ahh, it was too easy. The ITS file had a taxon that wasn't in other files so it was added with lots of missing data. Sometines this might be the result you want but having a few taxa like this is also a very good way to make a Partition Homogeneity Test run for a week. Lets write a function that tests that the same taxa are represented in a set of nexus instances and provides a useful error message if not (ie, what to delete from your nexus files if you want them to combine nicely)
def check_taxa(matrices): '''Checks that nexus instances in a list [(name, instance)...] have the same taxa, provides useful error if not and returns None if everything matches ''' first_taxa = matrices[0][1].taxlabels for name, matrix in matrices[1:]: first_only = [t for t in first_taxa if t not in matrix.taxlabels] new_only = [t for t in matrix.taxlabels if t not in first_taxa] if first_only: missing = ', '.join([t for t in first_only]) msg = '%s taxa %s not in martix %s' % (nexi[0][0], missing, name) raise Nexus.NexusError(msg) elif new_only: missing = ', '.join([t for t in new_only]) msg = '%s taxa %s not in all matrices' % (name, missing) raise Nexus.NexusError(msg) return None # will only get here if it hasn't thrown an exception def concat(file_list, same_taxa=True): ''' Combine multiple nexus data matrices in one partitioned file. By default this will only work if the same taxa are present in each file use same_taxa=False if you are not concerned by this ''' nexi = [(handle.name, Nexus.Nexus(handle)) for handle in file_list] if same_taxa: if not check_taxa(nexi): return Nexus.combine(nexi) else: return Nexus.combine(nexi)
And now, using our new functions:
>>> handles = [open('btCOI.nex', 'r'), open('btCOII.nex', 'r'), open('btITS.nex', 'r')]
# If we combine them all we should get an error and the taxon/taxa that caused it
>>> concat(handles)
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "<stdin>", line 5, in concat
File "<stdin>", line 16, in check_taxa
Bio.Nexus.Nexus.NexusError: btITS.nex taxa bt4 not in all matrices
# But if we use just the first two, which do have matching taxa, it should be fine
>>> concat(handles[:2]).taxlabels
['bt1', 'bt2', 'bt3']
# Ok, can we still munge them together if we want to?
>>> concat(l, same_taxa=False).taxlabels
['bt1', 'bt2', 'bt3', 'bt4']
Discussion
The details of the Nexus class are provided in the API Domcumentation