Package Bio :: Package SeqUtils :: Module MeltingTemp
[hide private]
[frames] | no frames]

Module MeltingTemp

source code

Calculate the thermodynamic melting temperatures of nucleotide sequences.

Functions [hide private]
 
Tm_staluc(s, dnac=50, saltc=50, rna=0)
Returns DNA/DNA tm using nearest neighbor thermodynamics.
source code
 
_test()
Run the module's doctests (PRIVATE).
source code
Function Details [hide private]

Tm_staluc(s, dnac=50, saltc=50, rna=0)

source code 
Returns DNA/DNA tm using nearest neighbor thermodynamics.

dnac is DNA concentration [nM]
saltc is salt concentration [mM].
rna=0 is for DNA/DNA (default), use 1 for RNA/RNA hybridisation.

For DNA/DNA, see Allawi & SantaLucia (1997), Biochemistry 36: 10581-10594
For RNA/RNA, see Xia et al (1998), Biochemistry 37: 14719-14735

Example:

>>> print "%0.2f" % Tm_staluc('CAGTCAGTACGTACGTGTACTGCCGTA')
59.87
>>> print "%0.2f" % Tm_staluc('CAGTCAGTACGTACGTGTACTGCCGTA', rna=True)
68.14

You can also use a Seq object instead of a string,

>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import generic_nucleotide
>>> s = Seq('CAGTCAGTACGTACGTGTACTGCCGTA', generic_nucleotide)
>>> print "%0.2f" % Tm_staluc(s)
59.87
>>> print "%0.2f" % Tm_staluc(s, rna=True)
68.14