Package Bio :: Package SeqUtils
[hide private]
[frames] | no frames]

Package SeqUtils

source code

Miscellaneous functions for dealing with sequences.

Submodules [hide private]

Functions [hide private]
Calculates G+C content, returns the percentage (float between 0 and 100).
source code
Calculates total G+C content plus first, second and third positions.
source code
GC_skew(seq, window=100)
Calculates GC skew (G-C)/(G+C) for multiple windows along the sequence.
source code
xGC_skew(seq, window=1000, zoom=100, r=300, px=100, py=100)
Calculates and plots normal and accumulated GC skew (GRAPHICS !!!).
source code
nt_search(seq, subseq)
Search for a DNA subseq in sequence.
source code
seq3(seq, custom_map={'*': 'Ter'}, undef_code='Xaa')
Turn a one letter code protein sequence into one with three letter codes.
source code
seq1(seq, custom_map={'Ter': '*'}, undef_code='X')
Turns a three-letter code protein sequence into one with single letter codes.
source code
molecular_weight(seq, seq_type=None, double_stranded=False, circular=False, monoisotopic=False)
Calculates the molecular weight of a DNA, RNA or protein sequence.
source code
six_frame_translations(seq, genetic_code=1)
Formatted string showing the 6 frame translations and GC content.
source code
Simple FASTA reader, returning a list of string tuples (DEPRECATED).
source code
Run the module's doctests (PRIVATE).
source code
Variables [hide private]
  __package__ = 'Bio.SeqUtils'
Function Details [hide private]


source code 
Calculates G+C content, returns the percentage (float between 0 and 100).

Copes mixed case sequences, and with the ambiguous nucleotide S (G or C)
when counting the G and C content.  The percentage is calculated against
the full length, e.g.:

>>> from Bio.SeqUtils import GC
>>> GC("ACTGN")

Note that this will return zero for an empty sequence.


source code 
Calculates total G+C content plus first, second and third positions.

Returns a tuple of four floats (percentages between 0 and 100) for the
entire sequence, and the three codon positions.  e.g.

>>> from Bio.SeqUtils import GC123
>>> GC123("ACTGTN")
(40.0, 50.0, 50.0, 0.0)

Copes with mixed case sequences, but does NOT deal with ambiguous

GC_skew(seq, window=100)

source code 
Calculates GC skew (G-C)/(G+C) for multiple windows along the sequence.

Returns a list of ratios (floats), controlled by the length of the sequence
and the size of the window.

Does NOT look at any ambiguous nucleotides.

nt_search(seq, subseq)

source code 
Search for a DNA subseq in sequence.

use ambiguous values (like N = A or T or C or G, R = A or G etc.)
searches only on forward strand

seq3(seq, custom_map={'*': 'Ter'}, undef_code='Xaa')

source code 
Turn a one letter code protein sequence into one with three letter codes.

The single input argument 'seq' should be a protein sequence using single
letter codes, either as a python string or as a Seq or MutableSeq object.

This function returns the amino acid sequence as a string using the three
letter amino acid codes. Output follows the IUPAC standard (including
ambiguous characters B for "Asx", J for "Xle" and X for "Xaa", and also U
for "Sel" and O for "Pyl") plus "Ter" for a terminator given as an asterisk.
Any unknown character (including possible gap characters), is changed into


>>> from Bio.SeqUtils import seq3
>>> seq3("MAIVMGRWKGAR*")

You can set a custom translation of the codon termination code using the
"custom_map" argument, e.g.

>>> seq3("MAIVMGRWKGAR*", custom_map={"*": "***"})

You can also set a custom translation for non-amino acid characters, such
as '-', using the "undef_code" argument, e.g.

>>> seq3("MAIVMGRWKGA--R*", undef_code='---')

If not given, "undef_code" defaults to "Xaa", e.g.

>>> seq3("MAIVMGRWKGA--R*")

This function was inspired by BioPerl's seq3.

seq1(seq, custom_map={'Ter': '*'}, undef_code='X')

source code 
Turns a three-letter code protein sequence into one with single letter codes.

The single input argument 'seq' should be a protein sequence using three-
letter codes, either as a python string or as a Seq or MutableSeq object.

This function returns the amino acid sequence as a string using the one
letter amino acid codes. Output follows the IUPAC standard (including
ambiguous characters "B" for "Asx", "J" for "Xle", "X" for "Xaa", "U" for
"Sel", and "O" for "Pyl") plus "*" for a terminator given the "Ter" code.
Any unknown character (including possible gap characters), is changed into


>>> from Bio.SeqUtils import seq3
>>> seq1("MetAlaIleValMetGlyArgTrpLysGlyAlaArgTer")

The input is case insensitive, e.g.

>>> from Bio.SeqUtils import seq3
>>> seq1("METalaIlEValMetGLYArgtRplysGlyAlaARGTer")

You can set a custom translation of the codon termination code using the
"custom_map" argument, e.g.

>>> seq1("MetAlaIleValMetGlyArgTrpLysGlyAlaArg***", custom_map={"***": "*"})

You can also set a custom translation for non-amino acid characters, such
as '-', using the "undef_code" argument, e.g.

>>> seq1("MetAlaIleValMetGlyArgTrpLysGlyAla------ArgTer", undef_code='?')

If not given, "undef_code" defaults to "X", e.g.

>>> seq1("MetAlaIleValMetGlyArgTrpLysGlyAla------ArgTer")

molecular_weight(seq, seq_type=None, double_stranded=False, circular=False, monoisotopic=False)

source code 
Calculates the molecular weight of a DNA, RNA or protein sequence.

Only unambiguous letters are allowed. Nucleotide sequences are assumed to
have a 5' phosphate.

seq: String or Biopython sequence object.
seq_type: The default (None) is to take the alphabet from the seq argument,
          or assume DNA if the seq argument is a string. Override this with
          a string 'DNA', 'RNA', or 'protein'.
double_stranded: Calculate the mass for the double stranded molecule?
circular: Is the molecule circular (has no ends)?
monoisotopic: Use the monoisotopic mass tables?

Note that for backwards compatibility, if the seq argument is a string,
or Seq object with a generic alphabet, and no seq_type is specified
(i.e. left as None), then DNA is assumed.

>>> print("%0.2f" % molecular_weight("AGC"))
>>> print("%0.2f" % molecular_weight(Seq("AGC")))

However, it is better to be explicit - for example with strings:

>>> print("%0.2f" % molecular_weight("AGC", "DNA"))
>>> print("%0.2f" % molecular_weight("AGC", "RNA"))
>>> print("%0.2f" % molecular_weight("AGC", "protein"))

Or, with the sequence alphabet:

>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import generic_dna, generic_rna, generic_protein
>>> print("%0.2f" % molecular_weight(Seq("AGC", generic_dna)))
>>> print("%0.2f" % molecular_weight(Seq("AGC", generic_rna)))
>>> print("%0.2f" % molecular_weight(Seq("AGC", generic_protein)))

Also note that contradictory sequence alphabets and seq_type will also
give an exception:

>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import generic_dna
>>> print("%0.2f" % molecular_weight(Seq("AGC", generic_dna), "RNA"))
Traceback (most recent call last):
ValueError: seq_type='RNA' contradicts DNA from seq alphabet

six_frame_translations(seq, genetic_code=1)

source code 
Formatted string showing the 6 frame translations and GC content.

nice looking 6 frame translation with GC content - code from xbbtools
similar to DNA Striders six-frame translation

>>> from Bio.SeqUtils import six_frame_translations
>>> print(six_frame_translations("AUGGCCAUUGUAAUGGGCCGCUGA"))
GC_Frame: a:5 t:0 g:8 c:5 
Sequence: auggccauug ... gggccgcuga, 24 nt, 54.17 %GC
  G  H  C  N  G  P  L
 W  P  L  *  W  A  A
M  A  I  V  M  G  R  *
auggccauuguaaugggccgcuga   54 %
A  M  T  I  P  R  Q 
 H  G  N  Y  H  A  A  S
  P  W  Q  L  P  G  S


source code 
Simple FASTA reader, returning a list of string tuples (DEPRECATED).

The single argument 'file' should be the filename of a FASTA format file.
This function will open and read in the entire file, constructing a list
of all the records, each held as a tuple of strings (the sequence name or
title, and its sequence).

>>> seqs = quick_FASTA_reader("Fasta/dups.fasta")
>>> for title, sequence in seqs:
...     print("%s %s" % (title, sequence))
alpha ACGTA
beta CGTC
gamma CCGCC
alpha (again - this is a duplicate entry to test the indexing code) ACGTA
delta CGCGC

This function was is fast, but because it returns the data as a single in
memory list, is unsuitable for large files where an iterator approach is

You are generally encouraged to use Bio.SeqIO.parse(handle, "fasta") which
allows you to iterate over the records one by one (avoiding having all the
records in memory at once).  Using Bio.SeqIO also makes it easy to switch
between different input file formats.  However, please note that rather
than simple strings, Bio.SeqIO uses SeqRecord objects for each record.

If you want to use simple strings, use the function SimpleFastaParser
added to Bio.SeqIO.FastaIO in Biopython 1.61 instead.