Package Bio :: Package SearchIO :: Package _model :: Module hsp
[hide private]
[frames] | no frames]

Source Code for Module Bio.SearchIO._model.hsp

   1  # Copyright 2012 by Wibowo Arindrarto.  All rights reserved. 
   2  # This code is part of the Biopython distribution and governed by its 
   3  # license.  Please see the LICENSE file that should have been included 
   4  # as part of this package. 
   6  """Bio.SearchIO objects to model high scoring regions between query and hit.""" 
   8  from __future__ import print_function 
   9  from Bio._py3k import basestring 
  11  import warnings 
  12  from operator import ge, le 
  14  from Bio import BiopythonWarning 
  15  from Bio.Align import MultipleSeqAlignment 
  16  from Bio.Alphabet import single_letter_alphabet 
  17  from Bio.Seq import Seq 
  18  from Bio.SeqRecord import SeqRecord 
  20  from Bio._utils import getattr_str, trim_str 
  21  from Bio.SearchIO._utils import singleitem, allitems, fullcascade, \ 
  22          fragcascade 
  24  from ._base import _BaseHSP 
27 -class HSP(_BaseHSP):
28 29 """Class representing high-scoring region(s) between query and hit. 30 31 HSP (high-scoring pair) objects are contained by Hit objects (see Hit). 32 In most cases, HSP objects store the bulk of the statistics and results 33 (e.g. e-value, bitscores, query sequence, etc.) produced by a search 34 program. 35 36 Depending on the search output file format, a given HSP will contain one 37 or more HSPFragment object(s). Examples of search programs that produce HSP 38 with one HSPFragments are BLAST, HMMER, and FASTA. Other programs such as 39 BLAT or Exonerate may produce HSPs containing more than one HSPFragment. 40 However, their native terminologies may differ: in BLAT these fragments 41 are called 'blocks' while in Exonerate they are called exons or NER. 42 43 Here are examples from each type of HSP. The first one comes from a BLAST 44 search: 45 46 >>> from Bio import SearchIO 47 >>> blast_qresult = next(SearchIO.parse('Blast/mirna.xml', 'blast-xml')) 48 >>> blast_hsp = blast_qresult[1][0] # the first HSP from the second hit 49 >>> blast_hsp 50 HSP(hit_id='gi|301171311|ref|NR_035856.1|', query_id='33211', 1 fragments) 51 >>> print(blast_hsp) 52 Query: 33211 mir_1 53 Hit: gi|301171311|ref|NR_035856.1| Pan troglodytes microRNA mir-520b ... 54 Query range: [1:61] (1) 55 Hit range: [0:60] (1) 56 Quick stats: evalue 1.7e-22; bitscore 109.49 57 Fragments: 1 (60 columns) 58 Query - CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG 59 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 60 Hit - CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG 61 62 For HSPs with a single HSPFragment, you can invoke `print` on it and see the 63 underlying sequence alignment, if it exists. This is not the case for HSPs 64 with more than one HSPFragment. Below is an example, using an HSP from a 65 BLAT search. Invoking `print` on these HSPs will instead show a table of the 66 HSPFragment objects it contains: 67 68 >>> blat_qresult ='Blat/mirna.pslx', 'blat-psl', pslx=True) 69 >>> blat_hsp = blat_qresult[1][0] # the first HSP from the second hit 70 >>> blat_hsp 71 HSP(hit_id='chr11', query_id='blat_1', 2 fragments) 72 >>> print(blat_hsp) 73 Query: blat_1 <unknown description> 74 Hit: chr11 <unknown description> 75 Query range: [42:67] (-1) 76 Hit range: [59018929:59018955] (1) 77 Quick stats: evalue ?; bitscore ? 78 Fragments: --- -------------- ---------------------- ---------------------- 79 # Span Query range Hit range 80 --- -------------- ---------------------- ---------------------- 81 0 6 [61:67] [59018929:59018935] 82 1 16 [42:58] [59018939:59018955] 83 84 Notice that in HSPs with more than one HSPFragments, the HSP's `query_range` 85 `hit_range` properties encompasses all fragments it contains. 86 87 You can check whether an HSP has more than one HSPFragments or not using the 88 `is_fragmented` property: 89 90 >>> blast_hsp.is_fragmented 91 False 92 >>> blat_hsp.is_fragmented 93 True 94 95 Since HSP objects are also containers similar to Python lists, you can 96 access a single fragment in an HSP using its integer index: 97 98 >>> blat_fragment = blat_hsp[0] 99 >>> print(blat_fragment) 100 Query: blat_1 <unknown description> 101 Hit: chr11 <unknown description> 102 Query range: [61:67] (-1) 103 Hit range: [59018929:59018935] (1) 104 Fragments: 1 (6 columns) 105 Query - tatagt 106 Hit - tatagt 107 108 This applies to HSPs objects with a single fragment as well: 109 110 >>> blast_fragment = blast_hsp[0] 111 >>> print(blast_fragment) 112 Query: 33211 mir_1 113 Hit: gi|301171311|ref|NR_035856.1| Pan troglodytes microRNA mir-520b ... 114 Query range: [1:61] (1) 115 Hit range: [0:60] (1) 116 Fragments: 1 (60 columns) 117 Query - CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG 118 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 119 Hit - CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG 120 121 Regardless of the search output file format, HSP objects provide the 122 properties listed below. These properties always return values in a list, 123 due to the HSP object itself being a list-like container. However, for 124 HSP objects with a single HSPFragment, shortcut properties that fetches 125 the item from the list are also provided. 126 127 +----------------------+---------------------+-----------------------------+ 128 | Property | Shortcut | Value | 129 +======================+=====================+=============================+ 130 | aln_all | aln | HSP alignments as | 131 | | | MultipleSeqAlignment object | 132 +----------------------+---------------------+-----------------------------+ 133 | aln_annotation_all | aln_annotation | dictionary of annotation(s) | 134 | | | of all fragments' alignments| 135 +----------------------+---------------------+-----------------------------+ 136 | fragments | fragment | HSPFragment objects | 137 +----------------------+---------------------+-----------------------------+ 138 | hit_all | hit | hit sequence as SeqRecord | 139 | | | objects | 140 +----------------------+---------------------+-----------------------------+ 141 | hit_features_all | hit_features | SeqFeatures of all hit | 142 | | | fragments | 143 +----------------------+---------------------+-----------------------------+ 144 | hit_start_all | hit_start* | start coordinates of the | 145 | | | hit fragments | 146 +----------------------+---------------------+-----------------------------+ 147 | hit_end_all | hit_end* | end coordinates of the hit | 148 | | | fragments | 149 +----------------------+---------------------+-----------------------------+ 150 | hit_span_all | hit_span* | sizes of each hit fragments | 151 +----------------------+---------------------+-----------------------------+ 152 | hit_strand_all | hit_strand | strand orientations of the | 153 | | | hit fragments | 154 +----------------------+---------------------+-----------------------------+ 155 | hit_frame_all | hit_frame | reading frames of the hit | 156 | | | fragments | 157 +----------------------+---------------------+-----------------------------+ 158 | hit_range_all | hit_range | tuples of start and end | 159 | | | coordinates of each hit | 160 | | | fragment | 161 +----------------------+---------------------+-----------------------------+ 162 | query_all | query | query sequence as SeqRecord | 163 | | | object | 164 +----------------------+---------------------+-----------------------------+ 165 | query_features_all | query_features | SeqFeatures of all query | 166 | | | fragments | 167 +----------------------+---------------------+-----------------------------+ 168 | query_start_all | query_start* | start coordinates of the | 169 | | | fragments | 170 +----------------------+---------------------+-----------------------------+ 171 | query_end_all | query_end* | end coordinates of the | 172 | | | query fragments | 173 +----------------------+---------------------+-----------------------------+ 174 | query_span_all | query_span* | sizes of each query | 175 | | | fragments | 176 +----------------------+---------------------+-----------------------------+ 177 | query_strand_all | query_strand | strand orientations of the | 178 | | | query fragments | 179 +----------------------+---------------------+-----------------------------+ 180 | query_frame_all | query_frame | reading frames of the query | 181 | | | fragments | 182 +----------------------+---------------------+-----------------------------+ 183 | query_range_all | query_range | tuples of start and end | 184 | | | coordinates of each query | 185 | | | fragment | 186 +----------------------+---------------------+-----------------------------+ 187 * may be used in HSPs with multiple fragments 188 189 For all types of HSP objects, the property will return the values in a list. 190 Shorcuts are only applicable for HSPs with one fragment. Except the ones 191 noted, if they are used on an HSP with more than one fragments, an exception 192 will be raised. 193 194 For properties that may be used in HSPs with multiple or single fragments 195 (`*_start`, `*_end`, and `*_span` properties), their interpretation depends 196 on how many fragment the HSP has: 197 198 +------------+---------------------------------------------------+ 199 | Property | Value | 200 +============+===================================================+ 201 | hit_start | smallest coordinate value of all hit fragments | 202 +------------+---------------------------------------------------+ 203 | hit_end | largest coordinate value of all hit fragments | 204 +------------+---------------------------------------------------+ 205 | hit_span | difference between `hit_start` and `hit_end` | 206 +------------+---------------------------------------------------+ 207 | query_start| smallest coordinate value of all query fragments | 208 +------------+---------------------------------------------------+ 209 | query_end | largest coordinate value of all query fragments | 210 +------------+---------------------------------------------------+ 211 | query_span | difference between `query_start` and `query_end` | 212 +------------+---------------------------------------------------+ 213 214 In addition to the objects listed above, HSP objects also provide the 215 following properties: 216 217 +--------------------+------------------------------------------------------+ 218 | Property | Value | 219 +====================+======================================================+ 220 | aln_span | total number of residues in all HSPFragment objects | 221 +--------------------+------------------------------------------------------+ 222 | alphabet | alphabet used in hit and query SeqRecord objects | 223 +--------------------+------------------------------------------------------+ 224 | is_fragmented | boolean, whether there are multiple fragments or not | 225 +--------------------+------------------------------------------------------+ 226 | hit_id | ID of the hit sequence | 227 +--------------------+------------------------------------------------------+ 228 | hit_description | description of the hit sequence | 229 +--------------------+------------------------------------------------------+ 230 | hit_inter_ranges | list of hit sequence coordinates of the regions | 231 | | between fragments | 232 +--------------------+------------------------------------------------------+ 233 | hit_inter_spans | list of lengths of the regions between hit fragments | 234 +--------------------+------------------------------------------------------+ 235 | query_id | ID of the query sequence | 236 +--------------------+------------------------------------------------------+ 237 | query_description | description of the query sequence | 238 +--------------------+------------------------------------------------------+ 239 | query_inter_ranges | list of query sequence coordinates of the regions | 240 | | between fragments | 241 +--------------------+------------------------------------------------------+ 242 | query_inter_spans | list of lengths of the regions between query | 243 | |fragments | 244 +--------------------+------------------------------------------------------+ 245 246 """ 247 # attributes we don't want to transfer when creating a new Hit class 248 # from this one 249 _NON_STICKY_ATTRS = ('_items', ) 250
251 - def __init__(self, fragments=[]):
252 """Initializes an HSP object. 253 254 Arguments: 255 fragments -- List of HSPFragment objects. 256 257 HSP objects must be initialized with a list containing at least one 258 HSPFragment object. If multiple HSPFragment objects are used for 259 initialization, they must all have the same `query_id`, 260 `query_description`, `hit_id`, `hit_description`, and alphabet 261 properties. 262 263 """ 264 if not fragments: 265 raise ValueError("HSP objects must have at least one HSPFragment " 266 "object.") 267 # check that all fragments contain the same IDs, descriptions, alphabet 268 for attr in ('query_id', 'query_description', 'hit_id', 269 'hit_description', 'alphabet'): 270 if len(set(getattr(frag, attr) for frag in fragments)) != 1: 271 raise ValueError("HSP object can not contain fragments with " 272 "more than one %s." % attr) 273 274 self._items = [] 275 for fragment in fragments: 276 self._validate_fragment(fragment) 277 self._items.append(fragment)
279 - def __repr__(self):
280 return "%s(hit_id=%r, query_id=%r, %r fragments)" % \ 281 (self.__class__.__name__, self.hit_id, self.query_id, len(self))
283 - def __iter__(self):
284 return iter(self._items)
286 - def __contains__(self, fragment):
287 return fragment in self._items
289 - def __len__(self):
290 return len(self._items)
291 292 #Python 3:
293 - def __bool__(self):
294 return bool(self._items)
295 296 #Python 2: 297 __nonzero__= __bool__ 298
299 - def __str__(self):
300 301 lines = [] 302 # set hsp info line 303 statline = [] 304 # evalue 305 evalue = getattr_str(self, 'evalue', fmt='%.2g') 306 statline.append('evalue ' + evalue) 307 # bitscore 308 bitscore = getattr_str(self, 'bitscore', fmt='%.2f') 309 statline.append('bitscore ' + bitscore) 310 lines.append('Quick stats: ' + '; '.join(statline)) 311 312 if len(self.fragments) == 1: 313 return '\n'.join([self._str_hsp_header(), '\n'.join(lines), 314 self.fragments[0]._str_aln()]) 315 else: 316 lines.append(' Fragments: %s %s %s %s' % 317 ('-'*3, '-'*14, '-'*22, '-'*22)) 318 pattern = '%16s %14s %22s %22s' 319 lines.append(pattern % ('#', 'Span', 'Query range', 'Hit range')) 320 lines.append(pattern % ('-'*3, '-'*14, '-'*22, '-'*22)) 321 for idx, block in enumerate(self.fragments): 322 # set hsp line and table 323 # alignment span 324 aln_span = getattr_str(block, 'aln_span') 325 # query region 326 query_start = getattr_str(block, 'query_start') 327 query_end = getattr_str(block, 'query_end') 328 query_range = '[%s:%s]' % (query_start, query_end) 329 # max column length is 20 330 query_range = trim_str(query_range, 22, '~]') 331 # hit region 332 hit_start = getattr_str(block, 'hit_start') 333 hit_end = getattr_str(block, 'hit_end') 334 hit_range = '[%s:%s]' % (hit_start, hit_end) 335 hit_range = trim_str(hit_range, 22, '~]') 336 # append the hsp row 337 lines.append(pattern % (str(idx), aln_span, query_range, hit_range)) 338 339 return self._str_hsp_header() + '\n' + '\n'.join(lines)
341 - def __getitem__(self, idx):
342 # if key is slice, return a new HSP instance 343 if isinstance(idx, slice): 344 obj = self.__class__(self._items[idx]) 345 self._transfer_attrs(obj) 346 return obj 347 return self._items[idx]
349 - def __setitem__(self, idx, fragments):
350 # handle case if hsps is a list of hsp 351 if isinstance(fragments, (list, tuple)): 352 for fragment in fragments: 353 self._validate_fragment(fragment) 354 else: 355 self._validate_fragment(fragments) 356 357 self._items[idx] = fragments
359 - def __delitem__(self, idx):
360 # note that this may result in an empty HSP object, which should be 361 # invalid 362 del self._items[idx]
364 - def _validate_fragment(self, fragment):
365 if not isinstance(fragment, HSPFragment): 366 raise TypeError("HSP objects can only contain HSPFragment " 367 "objects.") 368 # HACK: to make validation during __init__ work 369 if self._items: 370 if fragment.hit_id != self.hit_id: 371 raise ValueError("Expected HSPFragment with hit ID %r, " 372 "found %r instead." % (, fragment.hit_id)) 373 374 if fragment.hit_description != self.hit_description: 375 raise ValueError("Expected HSPFragment with hit " 376 "description %r, found %r instead." % \ 377 (self.description, fragment.hit_description)) 378 379 if fragment.query_id != self.query_id: 380 raise ValueError("Expected HSPFragment with query ID %r, " 381 "found %r instead." % (self.query_id, 382 fragment.query_id)) 383 384 if fragment.query_description != self.query_description: 385 raise ValueError("Expected HSP with query description %r, " 386 "found %r instead." % (self.query_description, 387 fragment.query_description))
388 389
390 - def _aln_span_get(self):
391 # length of all alignments 392 # alignment span can be its own attribute, or computed from 393 # query / hit length 394 return sum(frg.aln_span for frg in self.fragments)
395 396 aln_span = property(fget=_aln_span_get, 397 doc="""Total number of columns in all HSPFragment objects.""") 398 399 ## coordinate properties ##
400 - def _get_coords(self, seq_type, coord_type):
401 assert seq_type in ('hit', 'query') 402 assert coord_type in ('start', 'end') 403 coord_name = '%s_%s' % (seq_type, coord_type) 404 coords = [getattr(frag, coord_name) for frag in self.fragments] 405 if None in coords: 406 warnings.warn("'None' exist in %s coordinates; ignored" % 407 (coord_name), BiopythonWarning) 408 return coords
410 - def _hit_start_get(self):
411 return min(self._get_coords('hit', 'start'))
412 413 hit_start = property(fget=_hit_start_get, 414 doc="""Smallest coordinate value of all hit fragments""") 415
416 - def _query_start_get(self):
417 return min(self._get_coords('query', 'start'))
418 419 query_start = property(fget=_query_start_get, 420 doc="""Smallest coordinate value of all query fragments""") 421
422 - def _hit_end_get(self):
423 return max(self._get_coords('hit', 'end'))
424 425 hit_end = property(fget=_hit_end_get, 426 doc="""Largest coordinate value of all hit fragments""") 427
428 - def _query_end_get(self):
429 return max(self._get_coords('query', 'end'))
430 431 query_end = property(fget=_query_end_get, 432 doc="""Largest coordinate value of all hit fragments""") 433 434 ## coordinate-dependent properties ##
435 - def _hit_span_get(self):
436 try: 437 return self.hit_end - self.hit_start 438 except TypeError: # triggered if any of the coordinates are None 439 return None
440 441 hit_span = property(fget=_hit_span_get, 442 doc="""The number of hit residues covered by the HSP.""") 443
444 - def _query_span_get(self):
445 try: 446 return self.query_end - self.query_start 447 except TypeError: # triggered if any of the coordinates are None 448 return None
449 450 query_span = property(fget=_query_span_get, 451 doc="""The number of query residues covered by the HSP.""") 452
453 - def _hit_range_get(self):
454 return (self.hit_start, self.hit_end)
455 456 hit_range = property(fget=_hit_range_get, 457 doc="""Tuple of HSP hit start and end coordinates.""") 458
459 - def _query_range_get(self):
460 return (self.query_start, self.query_end)
461 462 query_range = property(fget=_query_range_get, 463 doc="""Tuple of HSP query start and end coordinates.""") 464
465 - def _inter_ranges_get(self, seq_type):
466 # this property assumes that there are no mixed strands in a hit/query 467 assert seq_type in ('query', 'hit') 468 strand = getattr(self, '%s_strand_all' % seq_type)[0] 469 coords = getattr(self, '%s_range_all' % seq_type) 470 # determine function used to set inter range 471 # start and end coordinates, given two pairs 472 # of fragment start and end coordinates 473 if strand == -1: 474 startfunc, endfunc = min, max 475 else: 476 startfunc, endfunc = max, min 477 inter_coords = [] 478 for idx, coord in enumerate(coords[:-1]): 479 start = startfunc(coords[idx]) 480 end = endfunc(coords[idx+1]) 481 inter_coords.append((min(start, end), max(start, end))) 482 483 return inter_coords
485 - def _hit_inter_ranges_get(self):
486 return self._inter_ranges_get('hit')
487 488 hit_inter_ranges = property(fget=_hit_inter_ranges_get, 489 doc="""Hit sequence coordinates of the regions between fragments""") 490
491 - def _query_inter_ranges_get(self):
492 return self._inter_ranges_get('query')
493 494 query_inter_ranges = property(fget=_query_inter_ranges_get, 495 doc="""Query sequence coordinates of the regions between fragments""") 496
497 - def _inter_spans_get(self, seq_type):
498 assert seq_type in ('query', 'hit') 499 attr_name = '%s_inter_ranges' % seq_type 500 return [coord[1] - coord[0] for coord in getattr(self, attr_name)]
502 - def _hit_inter_spans_get(self):
503 return self._inter_spans_get('hit')
504 505 hit_inter_spans = property(fget=_hit_inter_spans_get, 506 doc="""Lengths of regions between hit fragments""") 507
508 - def _query_inter_spans_get(self):
509 return self._inter_spans_get('query')
510 511 query_inter_spans = property(fget=_query_inter_spans_get, 512 doc="""Lengths of regions between query fragments""") 513 514 ## shortcuts for fragments' properties ## 515 516 # bool check if there's more than one fragments 517 is_fragmented = property(lambda self: len(self) > 1, 518 doc="""Whether the HSP has more than one HSPFragment objects""") 519 520 # first item properties with setters 521 hit_description = fullcascade('hit_description', 522 doc="""Description of the hit sequence""") 523 524 query_description = fullcascade('query_description', 525 doc="""Description of the query sequence""") 526 527 hit_id = fullcascade('hit_id', 528 doc="""ID of the hit sequence""") 529 530 query_id = fullcascade('query_id', 531 doc="""ID of the query sequence""") 532 533 alphabet = fullcascade('alphabet', 534 doc="""Alphabet used in hit and query SeqRecord objects""") 535 536 # properties for single-fragment HSPs 537 fragment = singleitem( 538 doc="""HSPFragment object, first fragment""") 539 540 hit = singleitem('hit', 541 doc="""Hit sequence as a SeqRecord object, first fragment""") 542 543 query = singleitem('query', 544 doc="""Query sequence as a SeqRecord object, first fragment""") 545 546 aln = singleitem('aln', 547 doc="""Alignment of the first fragment as a MultipleSeqAlignment object""") 548 549 aln_annotation = singleitem('aln_annotation', 550 doc="""Dictionary of annotation(s) of the first fragment's alignment""") 551 552 hit_features = singleitem('hit_features', 553 doc="""Hit sequence features, first fragment""") 554 555 query_features = singleitem('query_features', 556 doc="""Query sequence features, first fragment""") 557 558 hit_strand = singleitem('hit_strand', 559 doc="""Hit strand orientation, first fragment""") 560 561 query_strand = singleitem('query_strand', 562 doc="""Query strand orientation, first fragment""") 563 564 hit_frame = singleitem('hit_frame', 565 doc="""Hit sequence reading frame, first fragment""") 566 567 query_frame = singleitem('query_frame', 568 doc="""Query sequence reading frame, first fragment""") 569 570 # properties for multi-fragment HSPs 571 fragments = allitems(doc="""List of all HSPFragment objects""") 572 573 hit_all = allitems('hit', 574 doc="""List of all fragments' hit sequences as SeqRecord objects""") 575 576 query_all = allitems('query', 577 doc="""List of all fragments' query sequences as SeqRecord objects""") 578 579 aln_all = allitems('aln', 580 doc="""List of all fragments' alignments as MultipleSeqAlignment objects""") 581 582 aln_annotation_all = allitems('aln_annotation', 583 doc="""Dictionary of annotation(s) of all fragments' alignments""") 584 585 hit_features_all = allitems('hit_features', 586 doc="""List of all hit sequence features""") 587 588 query_features_all = allitems('query_features', 589 doc="""List of all query sequence features""") 590 591 hit_strand_all = allitems('hit_strand', 592 doc="""List of all fragments' hit sequence strands""") 593 594 query_strand_all = allitems('query_strand', 595 doc="""List of all fragments' query sequence strands""") 596 597 hit_frame_all = allitems('hit_frame', 598 doc="""List of all fragments' hit sequence reading frames""") 599 600 query_frame_all = allitems('query_frame', 601 doc="""List of all fragments' query sequence reading frames""") 602 603 hit_start_all = allitems('hit_start', 604 doc="""List of all fragments' hit start coordinates""") 605 606 query_start_all = allitems('query_starts', 607 doc="""List of all fragments' query start coordinates""") 608 609 hit_end_all = allitems('hit_ends', 610 doc="""List of all fragments' hit end coordinates""") 611 612 query_end_all = allitems('query_ends', 613 doc="""List of all fragments' query end coordinates""") 614 615 hit_span_all = allitems('hit_span', 616 doc="""List of all fragments' hit sequence size""") 617 618 query_span_all = allitems('query_span', 619 doc="""List of all fragments' query sequence size""") 620 621 hit_range_all = allitems('hit_range', 622 doc="""List of all fragments' hit start and end coordinates""") 623 624 query_range_all = allitems('query_range', 625 doc="""List of all fragments' query start and end coordinates""")
626 627
628 -class HSPFragment(_BaseHSP):
629 630 """Class representing a contiguous alignment of hit-query sequence. 631 632 HSPFragment forms the core of any parsed search output file. Depending on 633 the search output file format, it may contain the actual query and/or hit 634 sequences that produces the search hits. These sequences are stored as 635 SeqRecord objects (see SeqRecord): 636 637 >>> from Bio import SearchIO 638 >>> qresult = next(SearchIO.parse('Blast/mirna.xml', 'blast-xml')) 639 >>> fragment = qresult[0][0][0] # first hit, first hsp, first fragment 640 >>> print(fragment) 641 Query: 33211 mir_1 642 Hit: gi|262205317|ref|NR_030195.1| Homo sapiens microRNA 520b (MIR520... 643 Query range: [0:61] (1) 644 Hit range: [0:61] (1) 645 Fragments: 1 (61 columns) 646 Query - CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG 647 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 648 Hit - CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG 649 650 # the query sequence is a SeqRecord object 651 >>> fragment.query.__class__ 652 <class 'Bio.SeqRecord.SeqRecord'> 653 >>> print(fragment.query) 654 ID: 33211 655 Name: aligned query sequence 656 Description: mir_1 657 Number of features: 0 658 Seq('CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTT...GGG', DNAAlphabet()) 659 660 # the hit sequence is a SeqRecord object as well 661 >>> fragment.hit.__class__ 662 <class 'Bio.SeqRecord.SeqRecord'> 663 >>> print(fragment.hit) 664 ID: gi|262205317|ref|NR_030195.1| 665 Name: aligned hit sequence 666 Description: Homo sapiens microRNA 520b (MIR520B), microRNA 667 Number of features: 0 668 Seq('CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTT...GGG', DNAAlphabet()) 669 670 # when both query and hit are present, we get a MultipleSeqAlignment object 671 >>> fragment.aln.__class__ 672 <class 'Bio.Align.MultipleSeqAlignment'> 673 >>> print(fragment.aln) 674 DNAAlphabet() alignment with 2 rows and 61 columns 675 CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAG...GGG 33211 676 CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAG...GGG gi|262205317|ref|NR_030195.1| 677 678 """ 679
680 - def __init__(self, hit_id='<unknown id>', query_id='<unknown id>', 681 hit=None, query=None, alphabet=single_letter_alphabet):
682 683 self._alphabet = alphabet 684 self.aln_annotation = {} 685 686 self._hit_id = hit_id 687 self._query_id = query_id 688 689 for seq_type in ('query', 'hit'): 690 # query or hit attributes default attributes 691 setattr(self, '_%s_description' % seq_type, '<unknown description>') 692 setattr(self, '_%s_features' % seq_type, []) 693 # query or hit attributes whose default attribute is None 694 for attr in ('strand', 'frame', 'start', 'end'): 695 setattr(self, '%s_%s' % (seq_type, attr), None) 696 # self.query or self.hit 697 if eval(seq_type): 698 setattr(self, seq_type, eval(seq_type)) 699 else: 700 setattr(self, seq_type, None)
702 - def __repr__(self):
703 info = "hit_id=%r, query_id=%r" % (self.hit_id, self.query_id) 704 try: 705 info += ", %i columns" % len(self) 706 except AttributeError: 707 pass 708 return "%s(%s)" % (self.__class__.__name__, info)
710 - def __len__(self):
711 return self.aln_span
713 - def __str__(self):
714 return self._str_hsp_header() + '\n' + self._str_aln()
716 - def __getitem__(self, idx):
717 if self.aln is not None: 718 obj = self.__class__( 719 hit_id=self.hit_id, query_id=self.query_id, 720 alphabet=self.alphabet) 721 # transfer query and hit attributes 722 # let SeqRecord handle feature slicing, then retrieve the sliced 723 # features into the sliced HSPFragment 724 if self.query is not None: 725 obj.query = self.query[idx] 726 obj.query_features = obj.query.features 727 if self.hit is not None: 728 obj.hit = self.hit[idx] 729 obj.hit_features = obj.hit.features 730 # description, strand, frame 731 for attr in ('description', 'strand', 'frame'): 732 for seq_type in ('hit', 'query'): 733 attr_name = '%s_%s' % (seq_type, attr) 734 self_val = getattr(self, attr_name) 735 setattr(obj, attr_name, self_val) 736 # alignment annotation should be transferred, since we can compute 737 # the resulting annotation 738 obj.aln_annotation = {} 739 for key, value in self.aln_annotation.items(): 740 assert len(value[idx]) == len(obj) 741 obj.aln_annotation[key] = value[idx] 742 return obj 743 else: 744 raise TypeError("Slicing for HSP objects without " 745 "alignment is not supported.")
747 - def _str_aln(self):
748 lines = [] 749 # alignment length 750 aln_span = getattr_str(self, 'aln_span') 751 lines.append(' Fragments: 1 (%s columns)' % aln_span) 752 # sequences 753 if self.query is not None and self.hit is not None: 754 try: 755 qseq = str(self.query.seq) 756 except AttributeError: # query is None 757 qseq = '?' 758 try: 759 hseq = str(self.hit.seq) 760 except AttributeError: # hit is None 761 hseq = '?' 762 763 # similarity line 764 simil = '' 765 if 'similarity' in self.aln_annotation and \ 766 isinstance(self.aln_annotation.get('similarity'), basestring): 767 simil = self.aln_annotation['similarity'] 768 769 if self.aln_span <= 67: 770 lines.append("%10s - %s" % ('Query', qseq)) 771 if simil: 772 lines.append(" %s" % simil) 773 lines.append("%10s - %s" % ('Hit', hseq)) 774 else: 775 # adjust continuation character length, so we don't display 776 # the same residues twice 777 if self.aln_span - 66 > 3: 778 cont = '~' * 3 779 else: 780 cont = '~' * (self.aln_span - 66) 781 lines.append("%10s - %s%s%s" % ('Query', 782 qseq[:59], cont, qseq[-5:])) 783 if simil: 784 lines.append(" %s%s%s" % 785 (simil[:59], cont, simil[-5:])) 786 lines.append("%10s - %s%s%s" % ('Hit', 787 hseq[:59], cont, hseq[-5:])) 788 789 return '\n'.join(lines)
790 791 ## sequence properties ##
792 - def _set_seq(self, seq, seq_type):
793 """Checks the given sequence for attribute setting 794 795 Arguments: 796 seq -- String or SeqRecord to check 797 seq_type -- String of sequence type, must be 'hit' or 'query' 798 799 """ 800 assert seq_type in ('hit', 'query') 801 if seq is None: 802 return seq # return immediately if seq is None 803 else: 804 if not isinstance(seq, (basestring, SeqRecord)): 805 raise TypeError("%s sequence must be a string or a SeqRecord" 806 " object." % seq_type) 807 # check length if the opposite sequence is not None 808 opp_type = 'hit' if seq_type == 'query' else 'query' 809 opp_seq = getattr(self, '_%s' % opp_type, None) 810 if opp_seq is not None: 811 if len(seq) != len(opp_seq): 812 raise ValueError("Sequence lengths do not match. Expected: " 813 "%r (%s); found: %r (%s)." % (len(opp_seq), opp_type, 814 len(seq), seq_type)) 815 816 seq_id = getattr(self, '%s_id' % seq_type) 817 seq_desc = getattr(self, '%s_description' % seq_type) 818 seq_feats = getattr(self, '%s_features' % seq_type) 819 seq_name = 'aligned %s sequence' % seq_type 820 821 if isinstance(seq, SeqRecord): 822 = seq_id 823 seq.description = seq_desc 824 = seq_name 825 seq.features = seq_feats 826 seq.seq.alphabet = self.alphabet 827 elif isinstance(seq, basestring): 828 seq = SeqRecord(Seq(seq, self.alphabet), id=seq_id, name=seq_name, 829 description=seq_desc, features=seq_feats) 830 831 return seq
833 - def _hit_get(self):
834 return self._hit
836 - def _hit_set(self, value):
837 self._hit = self._set_seq(value, 'hit')
838 839 hit = property(fget=_hit_get, fset=_hit_set, 840 doc="""Hit sequence as a SeqRecord object, defaults to None""") 841
842 - def _query_get(self):
843 return self._query
845 - def _query_set(self, value):
846 self._query = self._set_seq(value, 'query')
847 848 query = property(fget=_query_get, fset=_query_set, 849 doc="""Query sequence as a SeqRecord object, defaults to None""") 850
851 - def _aln_get(self):
852 if self.query is None and self.hit is None: 853 return None 854 elif self.hit is None: 855 return MultipleSeqAlignment([self.query], self.alphabet) 856 elif self.query is None: 857 return MultipleSeqAlignment([self.hit], self.alphabet) 858 else: 859 return MultipleSeqAlignment([self.query, self.hit], self.alphabet)
860 861 aln = property(fget=_aln_get, 862 doc="""Query-hit alignment as a MultipleSeqAlignment object, 863 defaults to None""") 864
865 - def _alphabet_get(self):
866 return self._alphabet
868 - def _alphabet_set(self, value):
869 self._alphabet = value 870 try: 871 self.query.seq.alphabet = value 872 except AttributeError: 873 pass 874 try: 875 self.hit.seq.alphabet = value 876 except AttributeError: 877 pass
878 879 alphabet = property(fget=_alphabet_get, fset=_alphabet_set, 880 doc="""Alphabet object used in the fragment's sequences and alignment, 881 defaults to single_letter_alphabet""") 882
883 - def _aln_span_get(self):
884 # length of alignment (gaps included) 885 # alignment span can be its own attribute, or computed from 886 # query / hit length 887 if not hasattr(self, '_aln_span'): 888 if self.query is not None: 889 self._aln_span = len(self.query) 890 elif self.hit is not None: 891 self._aln_span = len(self.hit) 892 893 return self._aln_span
895 - def _aln_span_set(self, value):
896 self._aln_span = value
897 898 aln_span = property(fget=_aln_span_get, fset=_aln_span_set, 899 doc="""The number of alignment columns covered by the fragment""") 900 901 ## id, description, and features properties ## 902 hit_description = fragcascade('description', 'hit', 903 doc="""Hit sequence description""") 904 905 query_description = fragcascade('description', 'query', 906 doc="""Query sequence description""") 907 908 hit_id = fragcascade('id', 'hit', 909 doc="""Hit sequence ID""") 910 911 query_id = fragcascade('id', 'query', 912 doc="""Query sequence ID""") 913 914 hit_features = fragcascade('features', 'hit', 915 doc="""Hit sequence features""") 916 917 query_features = fragcascade('features', 'query', 918 doc="""Query sequence features""") 919 920 ## strand properties ##
921 - def _prep_strand(self, strand):
922 # follow SeqFeature's convention 923 if not strand in (-1, 0, 1, None): 924 raise ValueError("Strand should be -1, 0, 1, or None; not %r" % 925 strand) 926 return strand
928 - def _get_strand(self, seq_type):
929 assert seq_type in ('hit', 'query') 930 strand = getattr(self, '_%s_strand' % seq_type) 931 932 if strand is None: 933 # try to compute strand from frame 934 frame = getattr(self, '%s_frame' % seq_type) 935 if frame is not None: 936 try: 937 strand = frame // abs(frame) 938 except ZeroDivisionError: 939 strand = 0 940 setattr(self, '%s_strand' % seq_type, strand) 941 942 return strand
944 - def _hit_strand_get(self):
945 return self._get_strand('hit')
947 - def _hit_strand_set(self, value):
948 self._hit_strand = self._prep_strand(value)
949 950 hit_strand = property(fget=_hit_strand_get, fset=_hit_strand_set, 951 doc="""Hit sequence strand, defaults to None""") 952
953 - def _query_strand_get(self):
954 return self._get_strand('query')
956 - def _query_strand_set(self, value):
957 self._query_strand = self._prep_strand(value)
958 959 query_strand = property(fget=_query_strand_get, fset=_query_strand_set, 960 doc="""Query sequence strand, defaults to None""") 961 962 ## frame properties ##
963 - def _prep_frame(self, frame):
964 if not frame in (-3, -2, -1, 0, 1, 2, 3, None): 965 raise ValueError("Strand should be an integer between -3 and 3, " 966 "or None; not %r" % frame) 967 return frame
969 - def _hit_frame_get(self):
970 return self._hit_frame
972 - def _hit_frame_set(self, value):
973 self._hit_frame = self._prep_frame(value)
974 975 hit_frame = property(fget=_hit_frame_get, fset=_hit_frame_set, 976 doc="""Hit sequence reading frame, defaults to None""") 977
978 - def _query_frame_get(self):
979 return self._query_frame
981 - def _query_frame_set(self, value):
982 self._query_frame = self._prep_frame(value)
983 984 query_frame = property(fget=_query_frame_get, fset=_query_frame_set, 985 doc="""Query sequence reading frame, defaults to None""") 986 987 ## coordinate properties ##
988 - def _prep_coord(self, coord, opp_coord_name, op):
989 # coord must either be None or int 990 if coord is None: 991 return coord 992 assert isinstance(coord, int) 993 # try to get opposite coordinate, if it's not present, return 994 try: 995 opp_coord = getattr(self, opp_coord_name) 996 except AttributeError: 997 return coord 998 # if opposite coordinate is None, return 999 if opp_coord is None: 1000 return coord 1001 # otherwise compare it to coord ('>=' or '<=') 1002 else: 1003 assert op(coord, opp_coord) 1004 return coord
1006 - def _hit_start_get(self):
1007 return self._hit_start
1009 - def _hit_start_set(self, value):
1010 self._hit_start = self._prep_coord(value, 'hit_end', le)
1011 1012 hit_start = property(fget=_hit_start_get, fset=_hit_start_set, 1013 doc="""Hit sequence start coordinate, defaults to None""") 1014
1015 - def _query_start_get(self):
1016 return self._query_start
1018 - def _query_start_set(self, value):
1019 self._query_start = self._prep_coord(value, 'query_end', le)
1020 1021 query_start = property(fget=_query_start_get, fset=_query_start_set, 1022 doc="""Query sequence start coordinate, defaults to None""") 1023
1024 - def _hit_end_get(self):
1025 return self._hit_end
1027 - def _hit_end_set(self, value):
1028 self._hit_end = self._prep_coord(value, 'hit_start', ge)
1029 1030 hit_end = property(fget=_hit_end_get, fset=_hit_end_set, 1031 doc="""Hit sequence start coordinate, defaults to None""") 1032
1033 - def _query_end_get(self):
1034 return self._query_end
1036 - def _query_end_set(self, value):
1037 self._query_end = self._prep_coord(value, 'query_start', ge)
1038 1039 query_end = property(fget=_query_end_get, fset=_query_end_set, 1040 doc="""Query sequence end coordinate, defaults to None""") 1041 1042 ## coordinate-dependent properties ##
1043 - def _hit_span_get(self):
1044 try: 1045 return self.hit_end - self.hit_start 1046 except TypeError: # triggered if any of the coordinates are None 1047 return None
1048 1049 hit_span = property(fget=_hit_span_get, 1050 doc="""The number of residues covered by the hit sequence""") 1051
1052 - def _query_span_get(self):
1053 try: 1054 return self.query_end - self.query_start 1055 except TypeError: # triggered if any of the coordinates are None 1056 return None
1057 1058 query_span = property(fget=_query_span_get, 1059 doc="""The number of residues covered by the query sequence""") 1060
1061 - def _hit_range_get(self):
1062 return (self.hit_start, self.hit_end)
1063 1064 hit_range = property(fget=_hit_range_get, 1065 doc="""Tuple of hit start and end coordinates""") 1066
1067 - def _query_range_get(self):
1068 return (self.query_start, self.query_end)
1069 1070 query_range = property(fget=_query_range_get, 1071 doc="""Tuple of query start and end coordinates""")
1072 1073 1074 # if not used as a module, run the doctest 1075 if __name__ == "__main__": 1076 from Bio._utils import run_doctest 1077 run_doctest() 1078